Endoplasmic reticulum, Biology

Assignment Help:

ENDOPLASMIC RETICULUM

Bulk of the cytoplasmic  compartment of a cell is occupied by complex , continuous  channel  system  in the form a network  of closed membrane bound and  intercommunicating  branched tubules,  vesicles and flattened sacs ,This  system was  discovered by porter (1945)  and named endoplasmic  reticulum, by him in 1953. It is distinguished  into two part  rough or granular endoplasmic reticulum  and smooth  or agranular endoplasmic  reticulum ,At place  tubules  of the ER may be seen  connected  with plasma membrane and nuclear  envelope.

The wall of endoplasmic reticulum is a unit membrane  structurally resembling  the plasma  membrane .Its  outer surface faces the cytosol  and the  inner one faces the lumen of  the reticulum,  which  contains a  watery fluid , The  roughness of the RER is because  of numerous minute particles, called ribosomes, attached  to  its outer surface.

Functions of endoplasmic  reticulum:

1.  It provides  mechanical support  to the cytoplasm as  an accessory  to the cytoskeleton,

2.      It acts as a continuous intracellular  transport system  between   nucleus and  cytosol  and between  the cytosol and extracellular  medium, exchanging  materials with  the cyotosol by  osmosis, diffusion  and active transport .

3.      The RER collects  and stores, in the fluid of its cavity, the proteins synthesized  by its  surface  bound ribosomes. Many  of these proteins are first processed by Means of enzymes and , then transported to  the cytosol for use by  various  other organelles.

4.      The SER is rich in other  important metabolic  enzymes  which   bring  about  synthesis  of triglycerides for  storage such as in tissues, of phospholipids and   cholesterol in all cells for generating  new  units membrane  required for cell repair  growth  and division , and  of steroid  hormones inc certain endocrine glands.

5.       In liver cells, the SER is involved  insynthesis  of lipoproteins  carbohydrade  metabolism  synthesis  of glycogen , its  storage and its  subsequent breakdown   into  glucose .

6.       Its  vesicles reform the nuclear  membrane  at telophase stage   of cell  division , This membrane  dissolves at the earlier stages  of division .

7.      In  muscle cells. It serves   for  intracellular  conduction of impulses  and release and withdraw  of calcium ions.

8.      In lymphocytes , plasma  cells and liver cells etc.  SER is involved in  detoxification  of endogenous  and exogenous antigens.


Related Discussions:- Endoplasmic reticulum

Describe the process of crassulacean acid metabolism, Describe the process ...

Describe the process of Crassulacean acid metabolism. a) How is it advantageous to plants? b) Describe the major steps in Krebs cycle. Why is this cycle also called citric a

Define the skin capillary fragility test, Define the Skin Capillary Fragili...

Define the Skin Capillary Fragility Test? One of the earliest signs of ascorbic acid deficiency is the fragility of the capillaries. Capillary fragility is measured by applyin

Matlab, Write up your own Matlab program to do the job described by Show"...

Write up your own Matlab program to do the job described by Show">http://www.avatar.se/molbioinfo2001/dynprog/adv_dynamic.html Show a few examples, your code does work. You wil

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain methods used for estimation of vitamin c, Explain Methods Used For ...

Explain Methods Used For Estimation of Vitamin C? The most commonly used methods to determine ascorbic acid in foods are: 1. Titrimetric methods - The 2, 6 dichlorophenol in

Echinodermata - regeneration in invertebrates, Echinodermata - Regeneration...

Echinodermata - Regeneration in Invertebrates Asteroids (starfishes), ophiuroids (brittle stars) and crinoids (sea lilies) can reproduce their lost arms and although parts of

Nutrition, difference between holophytic nutrition and holozoic nutrition.

difference between holophytic nutrition and holozoic nutrition.

Explain the control of air pollution, Explain the Control of Air Pollution ...

Explain the Control of Air Pollution a. Air belongs to everyone Need it to treat air pollution as public problem   b. Air pollution is an inevitable concomitan

Define the marasmic kwashiorkor, Define the Marasmic Kwashiorkor? In co...

Define the Marasmic Kwashiorkor? In countries where the incidence of protein-calorie malnutrition (PCM) is high, a large number of cases show signs and symptoms of marasmus and

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd