Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Endoplasmic reticulum (ER) is the network of membranous tubules in the cytoplasm of a cell; involved in production of the phospholipids, proteins, and the other functions. Rough ER is studded with the ribosomes; smooth ER is not.
Genome wide association studies must account for the fact that covering the entire genome with marker loci will produce ______ associations between linked marker alleles and possib
Q. What is Short acting insulin? Short acting: This type of insulin begins working quickly, works hardest 2- 3 hours after injection but is completely gone after 4-6 hrs. So if
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain some Do's and Don'ts when working in Laboratory? 1) Always wear a lab coat when working a laboratory. 2) Ensure that no harm is caused to yourself or the people work
Air Pollution - Environmental Pollution The threat due to air pollution became apparent only when some severe episodes caused human casualty in USA, Britain (London) and Japan
Classification of Diabetes Mellitus a) Type1Diabetes Mellitus i) Type 1 a ii) Type 1 b b) Type 2 Diabetes Mellitus c) Others i) Gestational Diabetes Mellitus
What is aneuploidy? What are the conditions caused by the aneuploidies? The Aneuploidy is an abnormal number of chromosomes in the cells of an individual. The major aneuploi
What are the cell types that form the phloem? What are the main features of those cells? The major cells that form the phloem are the sieve elements and the companion cells. Th
Q. Conditions Necessary for Outbreak in salmonellosis? The food must contain or become contaminated with the Salmonella bacteria. These bacteria must be there in considerable n
Why is it difficult to produce efficient vaccines against a viral infection like dengue and AIDS? It is complex to make vaccines against dengue because there are four dissimila
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd