Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain some Limitations of Most Probable Number? 1. Large quantity of glassware is required. 2. Colony morphology cannot be determined. 3. It lacks precision.
Determine what is dermal branchiae? External extensions of outer epidermis and peritoneum of the echinoderm body cavity. Both outer epidermis and inner peritoneum are lined wit
Q. What are the factors that for influencing photosynthesis also interfere with the gross primary productivity? Mostly light and water, but as well mineral salts, carbon dioxid
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. How do birds reproduce? Birds like every vertebrate have sexual reproduction. Their embryos develop within shelled eggs containing extraembryonic membranes and exterior the
Clathrin-coated pits and vesicles are included in both the endocytosis of material at the plasma membrane and the exocytosis of proteins from the Golgi apparatus. Electron
Biotechnology: Biotechnology is, perhaps. best defined as the industrial utilisation of biological systems or processes. In sense, therefore, biote(biology ha existed fo
Vitamin- D deficiency Animals obtain vitamin D either through the diet or when skin is exposed to solar radiation. The deficiency of vitamin D is associated with reduced absor
Determine number of sucrose molecules in the solution When a solid is dissolved in a volatile solvent the vapour pressure of the solution is less than the vapour pressure of th
How do organisms adjust to changes in temperature? Some of the most ordinary way for an organism to adjust to changes in body temperature is by perspiration or panting.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd