Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Endocrine Organs
Endocrine organs, as explained earlier are those organs or tissues, which release chemical substances directly into blood stream. Not like exocrine glands they do not have ducts to carry their secretion, and are hence considered ductless glands. Table lists the endocrine glands of the higher invertebrate groups, the secretions they generate and the functions of the secretions. Among non-chordates neurosecretory cells (NSCs) form a significant constituent of the endocrine system.
Table: Endocrine Organs
These are nerve cells specialised for hormone production. Thus they combine neural and endocrine properties. Apart from this, endocrine glands may arise from the nervous system, by complete modification. Corpus cardiacum of insects is one such gland. Several non-chordates have also epithelial endocrine glands derived from embryonic ectoderm, mesoderm or endoderm layers. The optic glands of cephalopod molluscs, androgenic glands and Y-organs of crustaceans, and the corpus allatum and prothoracic glands of insects are some instances. You will be studying these structures and their functions in detail. But previous to we proceed further, let us look into the concept of neurosecretion a little more elaborately, since neurosecretion plays a significant role in regulating metabolic and reproductive functions in non- chordates.
TRANSPOR T THROUGH P.M. P.M. regulates transport of materials in and outside of cell P.M. is semi- permeable as it allows rapid passage to water molecules. P.M. is selectively
Infectious bursal disease (IBD) It is a highly contagious acute disease in young chicken up to 6 weeks of age causing high morbidity and low mortality. Bursa may atrophy at th
Which of the following is a true statement regarding alternate splicing? A. Alternate splicing permits for an increase in protein diversity by the differential use of exons whe
What is critical photoperiod? And How can the critical photoperiod relate to flowering be experimentally determined? Critical photoperiod is the limit of the photoperiod durati
Please answer the following two questions on Sequence X: 1) DNA sequence databases 1. What is the EMBL-Bank accession number for this sequence (use BLAST)? 2. Which gen
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In many tests it is acceptable to read a positive result before the incubation time is completed. why is this not the case with starch agar?
Define about the Metabolism of Copper? In food, most copper is present as Cu 2+ and some as Cu 1+ . This copper is bound to organic compounds especially protein. Gastric HCI p
what is welfare in biology
Q. Discuss the colour coding rules for biomedical waste management and handling? Colour coding biomedical waste( management and handling) rules, 1998
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd