Endocrine glands - placenta, Biology

Assignment Help:

PLACENTA -

  1. Placenta is the intimate connection between the foehls and the uterine wall of the mother to exchange the materials.
  2. Placenta is a tempormy endocrine gland.
  3. During pregnancy the placenta provides for the exchange of nutrients and wastes between the mother and the developing foetus.
  4. It secretes some hormones like oestrogens, progesterone, human chorionic gonadotropin (hCG), human chorionic somatomammotropin hCS (formerly known as human placental lactogen), chorionic thyrotropin, chorionic corticotropin and relaxin.
  5. Oestrogens and progesterone have the same roles as in the nonpregnant state. However, the placental progesterone also checks contraction of uterine muscles and thus helps in maintain pregnancy.
  6. hCG stimulates progesterone release from the corpus luteum and maintains it. Presence of hCG in urine indicates pregnancy.
  7. Human choronic somatomammotropin stimulates the growth of mammary glands.
  8. Placental relaxin causes relaxation of the ligaments of pubic symphysis and towards the termination of pregnancy it softens and widens the opening of the cervix (lower part of uterus) for easy child birth (parturition).

Related Discussions:- Endocrine glands - placenta

Define procedure for detection of number of bacteria in milk, Define Proced...

Define Procedure for Detection of Number of Bacteria in Milk? 1. Place a clean, non-greasy slide over the graph paper. 2. Spread 0.01 ml of the milk over an area of 1 cm2 as

Calculate how much of the absorbance of the bsa, For a sample containing bo...

For a sample containing both protein and nucleic acid, the absorbance measured at a particular wavelenght will be the sum of contributions from both types of molecule. using the pr

What are the three cell types that form the osseous tissue, What are the th...

What are the three main cell types that form the osseous tissue? What are their functions? The three major cell types of the osseous tissue are the osteoblasts, the osteocytes

Define the prevalence and incidence of bulimia nervosa, Define the Prevalen...

Define the Prevalence and Incidence of bulimia nervosa? Bulimia nervosa appears to have become more prevalent during the past 30 years. We do not have much data on Indian popul

Define working of kidney in excretion of zinc in humans, Define working of ...

Define working of Kidney in excretion of zinc in humans? Very small amount of zinc is excreted in the urine (0.3-0.7 mg/day), as most of the zinc filtered by the kidney is reab

Long-day plants (ldp) - plant responses to light-dark cycles, Long-Day Plan...

Long-Day Plants (LDP) - Plant Responses to Light-Dark Cycles The definition of this is exactly opposite to short-day plant. That is those plants which flower when given more t

Explain catastrophism, Catastrophism Once-popular belief which events in t...

Catastrophism Once-popular belief which events in the history of earth had occurred in the past a sudden events and by processes different from those operating today. The periods

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the buccal perforations, Buccal Perforations Buccal concavitie...

Buccal Perforations Buccal concavities in the bone can result in some threads of the implant being exposed. Where these are very circumscribed and covered with thick and well-

What is the embryonic development called, What are the cells produced in th...

What are the cells produced in the first stage of the embryonic development called? The cells that result from the cleavage (the first stage of the embryonic development) are k

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd