Emulsion products, Biology

Assignment Help:

Emulsion products

Ground meat products such as sausages, patties and luncheon meats are emulsion based products and their quality depends upon the ability of lean meat (fat free meat) in the presence of salt, polyphosphates, water and other additives to form emulsion with fat, which are relatively heat stable. Meat proteins are natural emulsifying agents in the meat emulsions. Meat emulsion is prepared by mincing the meat and blending with other ingredients and subsequently chopping in a bowl chopper to induce emulsification. Chopping temperature of meat is an important factor in achieving stability, since temperatures in excess of 15° to 20°C, emulsions begin to break down. Food cutters are used to comminute meat materials finely. The arrangement, number, shape, speed and sharpness of knives are the main factors influence cutter 's performance. Distance between knives and bowl should be adjusted to 0.7 mm. The degree of comminution and the appearance of the product are controlled to a degree by the order of addition, the relative speeds of the bowl and cutting knives and the total chopping time.

Reduction in production cost of meat products is achieved largely through economic formulations. Use of by-products, additives (salt, polyphosphate) and fillers/ binders/extenders (non meat ingredients) at appropriate level ensure reduction in formulation costs. Polyphosphates like tetra sodium pyrophosphate, sodium tripolyphosphate or a combination of food grade phosphates at 0.5 % level of formulation have a synergistic effect in improving the quality of meat products in combination with 1to 2 % salt. Product palatability is increased due to better retention of fat and spice as well as decreased cooking losses. Water or ice is added to the formulation up to 10 % level to dissolve salt and phosphate, solubilise the meat proteins, reduce heat during chopping and provide fluidity to the emulsion.

A variety of plant protein products are incorporated in meat products as functional component, which contribute in binding protein sites for a more compact yet tender comminuted product; reducing accumulation of surface fat resulting in a tastier, juicy cooked product; reducing weight and dimensional shrinkage and contributing a significantly high quality protein comparable to eggs and milk. A variety of non meat materials such as starches or flours, mashed potato,  soy products, milk solids, egg liquid or cooked eggs, rusk, suji and dal (processed pulses) are added to basic meat formulations to improve emulsion stability, cooking yield, slicing characteristic and flavour and reduce formulation costs. However, these meat fillers have negative effects upon products firmness. The level of addition varies from 2 to 20 % depending upon the additive, product and functionality desired.


Related Discussions:- Emulsion products

Eggs, What is the type of egg in which yolk is absent?

What is the type of egg in which yolk is absent?

Echinoderm - circulatory and nervous system, Q. Echinoderm identity card. H...

Q. Echinoderm identity card. How are echinoderms characterized according to examples of representing beings, basic morphology, type of symmetry, germ layers and coelom, respiratory

Define traditional methods of food processing, Define Traditional Methods o...

Define Traditional Methods of Food Processing? Because food is so important to survival and most foods remain edible for only a brief period of time, people as the initial ages

Phases of cell cycle, The cell goes through many discrete phases before and...

The cell goes through many discrete phases before and after cell division. From this understanding, scientists then identified the four characteristic phases of the cell cycle:

Show the energy pyramids, Q. Can the amount of available energy in a given ...

Q. Can the amount of available energy in a given trophic level be larger than the available energy in inferior trophic levels? What does that condition means to the conformation of

Explain the kidney function in human biology, Explain the Kidney Function i...

Explain the Kidney Function in human biology? Blood first enters the capillaries in Bowman's capsule where it is filtered. The pores in the capillary walls allow water and smal

Determine reagents for determination of protein content, Determine Reagents...

Determine Reagents for Determination of Protein Content Using Biuret Method? Collect the following reagents to conduct the experiment: 1. 0.2 N NaOH solution - Dissolve 8 g

Animal tissue culture , Animal Tissue Culture: The term tissue culture ...

Animal Tissue Culture: The term tissue culture refers to the culture of all organs, tissue fragments and dispersed cells on a suitable nutrient medium. It may be divided into

Contractility, Myocardial contractility is mostly dependent on the level of...

Myocardial contractility is mostly dependent on the level of sympathetic nerve activity and is also increased by circulating catecholamines and inotropic drugs like dopamine and do

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd