Embryo-sac, Biology

Assignment Help:

Embryo-sac :

Embryo-sac is formed from megaspore mother cell.

  1. In embro-sac, there are 7 cells arranged in 3 groups. The 7 cells are one egg (female gamete), 2 synergids, one central cell (secondary nucleus) and 3 antipodals.
  2. All the cells except secondary nucleus are in haploid condition (n) secondary nucleus is diploid (2n)
  3. The synergids are also known as helper cells. These cells direct the growth of pollen tube towards the egg. They have beak like structure and are situated near the micropylar end.
  4. The 3 antipodals live only for a short duration. They are situated near the chalazal end of the embryo-sac.

908_Embryo-sac.png


Related Discussions:- Embryo-sac

Determine about the nervous tissues, Determine about the nervous tissues ...

Determine about the nervous tissues The nervous tissues throughout the body, including the visual nervous system, are continuously active. Electrical reactions can only be indu

Criteria of essentiality, Criteria of Essentiality Amon and Stout as e...

Criteria of Essentiality Amon and Stout as early as 1939, suggested certain criteria that an element must fulfil in order to be classified as essential. These criteria are lis

Morphological differences between monocot and dicot plants, Q. What are the...

Q. What are the major morphological differences between monocot plants and dicot plants? The main separation criteria between monocots and dicots are: number of cotyledons (see

Define principle behind the functioning of a ph meter, Define Principle beh...

Define Principle behind the functioning of a pH meter? Principle Hydrogen ions in solution, like other ionic species, conduct an electric current. When a glass electrode is dip

Human embryo, Human embryo: After fertilization the human embryo divide...

Human embryo: After fertilization the human embryo divides mitotically and develops two membranes: 1) Chorion 2) Amnion Functions of the membranes: i) Chorion : It

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Hemodynamic measurements of tricuspid stenosis, Q. Hemodynamic Measurements...

Q. Hemodynamic Measurements of tricuspid stenosis? Unless one suspects it clinically and echocardiographically, and plans the hemodynamic study - diagnosis of tricuspid stenosi

List the parameters in which we evaluate implant prosthesis, List the param...

List the parameters under which you will evaluate implant prosthesis The various parameters under which implant prosthesis can be evaluated are: i) Assessment of mobility.

What are sensory receptors, Q. What are sensory receptors? Sensory rece...

Q. What are sensory receptors? Sensory receptors are structures specialized in the acquiring of information, mechanical pressure, like temperature, pH, luminosity and chemical

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd