Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Electrophoresis is the technique of separating the large molecules (for instance DNA fragments or proteins) from the mixture of identical molecules. An electric current is passed through the medium containing mixture, and each type of the molecule travels through the medium at the dissimilar rate, depending on its electrical charge and size of it. The eparation is based on these differences. The agarose and acrylamide gels are the media generally used for electrophoresis of proteins and nucleic acids.
Determine sequence weights for the sequences ACTA, ACTT, CGTT, and AGAT in problem 1 by using Thompson, Higgins, and Gibson method a) compute pairwise distances between sequences
Which of the following compounds results from cyclization of glucose? Select one: a. alpha-D-glucopyronose b. beta-D-glucopyronose c. alpha-D-glucofuranose d. beta-D
What do you understand by Serial homology? Metamerization results in a linear series of segments which share a common embryonic origin. Ancestrally, all metameres were identica
Explain Some food applications of pectin As with other viscous polyanions such as carrageenan, pectin may be protective towards milk casein colloids, enhancing the properties (
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
advantage sand disadvantages of protozoa
Which of the following is a false statement regarding the activity of DNA polymerase during the replication process? A. DNA polymerase reads the template strand in the 5' to 3
Nucleosides : compounds formed from a nitrogenousbase and a penstose sugar.
Define early ebb or shock phase - Physiological Response to injury? This is usually brief in duration lasting 12 to 24 hours and occurs immediately following injury. Blood pres
Q. What is the cell division during the first stage of the embryonic development called? How is this stage characterized? The cell division in the first stage of the embryonic
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd