Electrophoresis, Biology

Assignment Help:

Electrophoresis is the technique of separating the large molecules (for instance DNA fragments or proteins) from the mixture of identical molecules. An electric current is passed through the medium containing mixture, and each type of the molecule travels through the medium at the dissimilar rate, depending on its electrical charge and size of it. The eparation is based on these differences. The agarose and acrylamide gels are the media generally used for electrophoresis of proteins and nucleic acids.


Related Discussions:- Electrophoresis

Biotechnology, Determine sequence weights for the sequences ACTA, ACTT, CGT...

Determine sequence weights for the sequences ACTA, ACTT, CGTT, and AGAT in problem 1 by using Thompson, Higgins, and Gibson method a) compute pairwise distances between sequences

Which compounds results from cyclization of glucose, Which of the following...

Which of the following compounds results from cyclization of glucose? Select one: a. alpha-D-glucopyronose b. beta-D-glucopyronose c. alpha-D-glucofuranose d. beta-D

What do you understand by serial homology, What do you understand by Serial...

What do you understand by Serial homology? Metamerization results in a linear series of segments which share a common embryonic origin. Ancestrally, all metameres were identica

Explain some food applications of pectin, Explain Some food applications of...

Explain Some food applications of pectin As with other viscous polyanions such as carrageenan, pectin may be protective towards milk casein colloids, enhancing the properties (

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Protozoa, advantage sand disadvantages of protozoa

advantage sand disadvantages of protozoa

Activity of dna polymerase during the replication process, Which of the fo...

Which of the following is a false statement regarding the activity of DNA polymerase during  the replication process? A. DNA polymerase reads the template strand in the 5' to 3

Explain nucleosides, Nucleosides : compounds formed from a nitrogenousba...

Nucleosides : compounds formed from a nitrogenousbase and  a penstose sugar.

Define ebb or shock phase - physiological response to injury, Define early ...

Define early ebb or shock phase - Physiological Response to injury? This is usually brief in duration lasting 12 to 24 hours and occurs immediately following injury. Blood pres

Explain first stage of the embryonic development, Q. What is the cell divis...

Q. What is the cell division during the first stage of the embryonic development called? How is this stage characterized? The cell division in the first stage of the embryonic

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd