Electrodialysis, Biology

Assignment Help:

This method is used for the desalination of water i.e., for the removal of dissolved mineral salts, acids, alkalis and also the radioactive substances from the effluents. Electro dialysis is performed in a multi-chamber membrane apparatus, known as electrodialyser, under the influence of electric current.

An electrodialyser is divided by alternating cation exchange and anion exchange membranes into concentrating and desalinating chambers.

These members have fixed charge-negative or positive-whereby they become impermeable to either anions or cations. Under the influence of electric field the cations motion to the cathode penetrate through the cation exchange membranes and retained by anion exchange membranes while the anions moving to the cation exchahge membranes and are retained by cation exchange resins . As a result, the ions of both the charges are removed from one row or chamber and desalinated water from the other.

This technique is useful for the production of fresh water on arid-coastal regions.  In Japan, electrodialysis eg sea-water is the principal source of salt.

 

 


Related Discussions:- Electrodialysis

Glands associated with eyes, GLANDS - 1 .       LACRYMAL GLANDS - ...

GLANDS - 1 .       LACRYMAL GLANDS - Tear glands numbers are 3. Its secretion is aquous & salty, keeps eye ball wet, give nourishment to cornea. Lysozyme also present

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain precautions for preparation of bacterial smear, Explain Precautions...

Explain Precautions for Preparation of Bacterial Smear? 1. Plates used should be prepared 24 hours before use to avoid spreading of colonies due to moisture in plates. 2. Sw

Explain the diagnostic set-up surgical stent, Explain the diagnostic set-up...

Explain the diagnostic set-up surgical stent The patient should understand the procedure and be warned of any complications. They should have agreed with the treatment plan, t

Photosynthesis carbon dioxide, Q. Why is it said that during photosynthesis...

Q. Why is it said that during photosynthesis carbon dioxide is improved to form glucose? During photosynthesis carbon dioxide is energetically improve with hydrogen from water.

Occurrence of earthquake, Among the different natural hazards, earthquakes ...

Among the different natural hazards, earthquakes happen to be the most feared and dangerous because of their sudden impact and the devastation they cause in a matter of few seconds

Polyinvagination or ingression, PO L YIN V AGIN A TIO N OR INGRESSIO...

PO L YIN V AGIN A TIO N OR INGRESSION - This is found in discoblastula and periblastula. In it the blastomeres of the blastoderm divide and form new blastomeres wh

What does secondary productivity in an ecosystem indicate, a) What does sec...

a) What does secondary productivity in an ecosystem indicate? b) List any two factors by which productivity is limited in aquatic ecosystems

What do you understand by exoskeleton, What do you understand by Exoskeleto...

What do you understand by Exoskeleton. Supporting structures of skeleton not surrounded by the body. Endoskeletal elements are secreted by an underlying epidermis and one side

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd