Elaborate proteins, Biology

Assignment Help:

Elaborate Proteins?

Proteins:  Proteins are the primary constituents of most living cells. Proteins are important components of cell membranes, and they form structures such as hair, fingernails, muscle tissue, cartilage, ligaments, tendons, hemoglobin, antibodies, and enzymes. Enzymes control most of the metabolic processes in a cell. Proteins contain carbon, hydrogen, oxygen, and nitrogen, and lesser quantities of other elements. Their basic structure consists of monomers (single subunits) called amino acids, named after the amino group, or NH2 in each molecule, and the carboxyl group, COOH, that forms the negatively charged acid part of the molecule.

 

 


Related Discussions:- Elaborate proteins

Importance of forests - habitat and food, Importance of Forests - Habitat a...

Importance of Forests - Habitat and Food Forests provide habitat, and food as well as protection to wildlife species against extremes of climate and help in balancing carbon d

Breathing and exchanges of gases , What happens to respiratory system in a ...

What happens to respiratory system in a man going up a hill?

Explain proteins as carriers, Explain Proteins as carriers? A large var...

Explain Proteins as carriers? A large variety of compounds are carried in the blood between tissues and organs of the body. Some of the compounds require specific protein for t

Explain flucytosine, Explain Flucytosine Flucytosine (Ancobon) - Potent...

Explain Flucytosine Flucytosine (Ancobon) - Potentially lethal, dose-related bone mar- row toxicity, colitis and rapid development of resistance when used alone limit the use o

Congenital anomalies of small and large intestines, Congenital Anomalies of...

Congenital Anomalies of Small and Large Intestines: 1) Intussusecption  Intussusecption  is the invagination or telescoping  of one part of  the intestine into another part

Define the process of digestion of fats, Define the Process of Digestion of...

Define the Process of Digestion of Fats? The enzyme in human gut which is responsible for fat digestion is 'lipase', Lipase is secreted by both stomach and pancreas. In stomach

Calculate the amount of nacl, A saline drip is to be prepared for a lab exp...

A saline drip is to be prepared for a lab experiment that is looking at hydration in lab rats. Calculate the amount of NaCl need to make 4 liters of a 0.9% solution.

Investigating, What is scientific investigation?

What is scientific investigation?

System that permits movement and fixation to echinoderms, What is the syste...

What is the system that permits movement and fixation to echinoderms? The system that allows movement and fixation to substrates in echinoderms is known as the ambulacral syste

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd