Elaborate proteins, Biology

Assignment Help:

Elaborate Proteins?

Proteins:  Proteins are the primary constituents of most living cells. Proteins are important components of cell membranes, and they form structures such as hair, fingernails, muscle tissue, cartilage, ligaments, tendons, hemoglobin, antibodies, and enzymes. Enzymes control most of the metabolic processes in a cell. Proteins contain carbon, hydrogen, oxygen, and nitrogen, and lesser quantities of other elements. Their basic structure consists of monomers (single subunits) called amino acids, named after the amino group, or NH2 in each molecule, and the carboxyl group, COOH, that forms the negatively charged acid part of the molecule.

 

 


Related Discussions:- Elaborate proteins

Wetlands - lentic ecosystems, Wetlands - Lentic Ecosystems Wetlands a...

Wetlands - Lentic Ecosystems Wetlands are permanently or periodically water covered areas. They can be defined as submerged or saturated lands either artificially or naturall

Determine the pre-conditions for gtt, Pre-conditions for GTT You are ad...

Pre-conditions for GTT You are advised to carry out the GTT (OGTT) test to confirm a diagnosis of diabetes mellitus for a person with: a) The history of glycosuria (glucose

Define growth studies for studying nutrient requirement, Define Growth Stud...

Define Growth Studies for studying Nutrient Requirement? Nutrient requirements of infants and young children are estimated by studying the rate of growth of healthy children an

Evolution, describe the two scientific models for evolution (gradualism, pu...

describe the two scientific models for evolution (gradualism, punctuated equilibrium)

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is ATP which invovles in use/transfer of all cells, The use and transf...

The use and transfer of energy in all cells involves same compound, ATP. The letters ATP stand for chemical: a) Adenosine triphosphate b) Aluminum trioxide c) Atrophine t

What are main limitations on size that can be synthesized, What are main li...

What are main limitations on size that can be synthesized and how will that be change over next few years? A: Today, a 10kb gene or longer is built as part of the regular produ

Trichomonas vaginalis - protozoan, Trichomonas vaginalis - Protozoan T...

Trichomonas vaginalis - Protozoan This cosmopolitan protozoan lives exclusively in the female vagina and male urethra or prostate. It causes a mild disease called trichomonas

Gel electrophore, How can you see a DNA by size if it too small to see wit...

How can you see a DNA by size if it too small to see with a microscope

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd