Elaborate proteins, Biology

Assignment Help:

Elaborate Proteins?

Proteins:  Proteins are the primary constituents of most living cells. Proteins are important components of cell membranes, and they form structures such as hair, fingernails, muscle tissue, cartilage, ligaments, tendons, hemoglobin, antibodies, and enzymes. Enzymes control most of the metabolic processes in a cell. Proteins contain carbon, hydrogen, oxygen, and nitrogen, and lesser quantities of other elements. Their basic structure consists of monomers (single subunits) called amino acids, named after the amino group, or NH2 in each molecule, and the carboxyl group, COOH, that forms the negatively charged acid part of the molecule.

 

 


Related Discussions:- Elaborate proteins

Male reproductive system - semen, SEMEN - Sperms and secretion of acces...

SEMEN - Sperms and secretion of accesory glands collectively known as seminal fluid or semen. It is milky, semi-solid in nature having particular smell. pH : 7.35 - 7.5. Spe

Kjlkjkp, Ask quesouou9ution #Minimum 100 words accepted#

Ask quesouou9ution #Minimum 100 words accepted#

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Why the ph of urine can be quite variable, The ph of urine can be quite var...

The ph of urine can be quite variable. Why? Why is bromothymol blue used as a ph indicator instead of phenal red when titrating blood?

Explain about non-surgical therapy, Non-Surgical Therapy The most conse...

Non-Surgical Therapy The most conservative approach to treatment involves non-surgical therapy. This treatment modality includes three subcategories: a) Pharmacological ther

Can you explain coronary angioplasty, Q. Can you explain Coronary Angioplas...

Q. Can you explain Coronary Angioplasty? The concept of coronary angioplasty - enlargement of the lumen of a stenotic vessel by a catheter technique was first proposed by Dotte

Define the vital force hypothesis, How did Pasteur's experiment answer the ...

How did Pasteur's experiment answer the objections raised by supporters of the "vital force" hypothesis? Pasteur's experiment allowed air from the out- side to mix with air fro

Genetic defects in dna repair and human disease, Genetic Defects in DNA rep...

Genetic Defects in DNA repair and human disease: 1. Xeroderma pigmentosum is an inherited disease that is characterized by severe photosensitivity and a very high incidence of

Explain about dietary management, Q. Explain about Dietary Management? ...

Q. Explain about Dietary Management? Treatment for gout often include a diet of lower purine intake. Indeed, about one third of the body's uric acid can be attributed to diet.

Explain how a cell produces and releases proteins, Explain how a cell produ...

Explain how a cell produces and releases proteins. Proteins are made on ribosomes and packaged into vesicles by the Golgi apparatus. The vesicles move to the cell membrane and

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd