Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Elaborate Proteins?
Proteins: Proteins are the primary constituents of most living cells. Proteins are important components of cell membranes, and they form structures such as hair, fingernails, muscle tissue, cartilage, ligaments, tendons, hemoglobin, antibodies, and enzymes. Enzymes control most of the metabolic processes in a cell. Proteins contain carbon, hydrogen, oxygen, and nitrogen, and lesser quantities of other elements. Their basic structure consists of monomers (single subunits) called amino acids, named after the amino group, or NH2 in each molecule, and the carboxyl group, COOH, that forms the negatively charged acid part of the molecule.
Wetlands - Lentic Ecosystems Wetlands are permanently or periodically water covered areas. They can be defined as submerged or saturated lands either artificially or naturall
Pre-conditions for GTT You are advised to carry out the GTT (OGTT) test to confirm a diagnosis of diabetes mellitus for a person with: a) The history of glycosuria (glucose
Define Growth Studies for studying Nutrient Requirement? Nutrient requirements of infants and young children are estimated by studying the rate of growth of healthy children an
describe the two scientific models for evolution (gradualism, punctuated equilibrium)
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
The use and transfer of energy in all cells involves same compound, ATP. The letters ATP stand for chemical: a) Adenosine triphosphate b) Aluminum trioxide c) Atrophine t
virus symmetry
What are main limitations on size that can be synthesized and how will that be change over next few years? A: Today, a 10kb gene or longer is built as part of the regular produ
Trichomonas vaginalis - Protozoan This cosmopolitan protozoan lives exclusively in the female vagina and male urethra or prostate. It causes a mild disease called trichomonas
How can you see a DNA by size if it too small to see with a microscope
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd