Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Elaborate Proteins?
Proteins: Proteins are the primary constituents of most living cells. Proteins are important components of cell membranes, and they form structures such as hair, fingernails, muscle tissue, cartilage, ligaments, tendons, hemoglobin, antibodies, and enzymes. Enzymes control most of the metabolic processes in a cell. Proteins contain carbon, hydrogen, oxygen, and nitrogen, and lesser quantities of other elements. Their basic structure consists of monomers (single subunits) called amino acids, named after the amino group, or NH2 in each molecule, and the carboxyl group, COOH, that forms the negatively charged acid part of the molecule.
SEMEN - Sperms and secretion of accesory glands collectively known as seminal fluid or semen. It is milky, semi-solid in nature having particular smell. pH : 7.35 - 7.5. Spe
Ask quesouou9ution #Minimum 100 words accepted#
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
The ph of urine can be quite variable. Why? Why is bromothymol blue used as a ph indicator instead of phenal red when titrating blood?
Non-Surgical Therapy The most conservative approach to treatment involves non-surgical therapy. This treatment modality includes three subcategories: a) Pharmacological ther
Q. Can you explain Coronary Angioplasty? The concept of coronary angioplasty - enlargement of the lumen of a stenotic vessel by a catheter technique was first proposed by Dotte
How did Pasteur's experiment answer the objections raised by supporters of the "vital force" hypothesis? Pasteur's experiment allowed air from the out- side to mix with air fro
Genetic Defects in DNA repair and human disease: 1. Xeroderma pigmentosum is an inherited disease that is characterized by severe photosensitivity and a very high incidence of
Q. Explain about Dietary Management? Treatment for gout often include a diet of lower purine intake. Indeed, about one third of the body's uric acid can be attributed to diet.
Explain how a cell produces and releases proteins. Proteins are made on ribosomes and packaged into vesicles by the Golgi apparatus. The vesicles move to the cell membrane and
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd