Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Ecosystem Balance
We take up, another parameter of ecosystem balance. One factor that affects the stability or persistence of some ecosystems under small or moderate environmental stress is species diversity - the number of species and their relative abundance in a given ecosystem. High species diversity tends to increase long-term persistence of the ecosystem.
It is because with so many different species and the linkages between them, risk is spread more widely. An ecosystem having a good variety of species has more ways available to respond to most environmental stresses. For example, the loss or drastic reduction of one species in an ecosystem, with complex food web usually does not threaten the existence of others, because most consumers have several alternative food supplies. In contrast, the highly specialised agricultural ecosystem, planted with only one type of crop such as wheat or rice is highly vulnerable to destruction from a single plant disease or insects. Therefore, the essence of the whole discussion is that most balanced ecosystems contain many different species.
Glycosides Calcinogenic glycosides: Certain plants contain glycosides of the active metabolite of vitamin D. The metabolite is called 1, 25-dihydroxycholecalciferol or mo
In the fruit fly Drosophila, a rudimentary wing called "vestigial" and dark body color called "ebony" are inherited at independent loci and are recessive to their dominant wild-typ
Anemochory - Dispersal of Seeds Seeds that are dispersed by air currents are usually light or are provided with special structures to help them remain air-borne for long peri
Where do PGA and glycine gain entry respectively after being formed during photorespiration in plants? What occurs to them immediately after?
What is a centimorgan? Centimorgan, or recombination unit, by convention is a distance among two linked genes that corresponds to 1% of recombination frequency of these genes.
History of diet nnd or tube feeding tolerance History of diet nnd or tube feeding tolerance: The dietitian presents the patient's history, which may include presence or hi
Explain colloidal state Foods contain a high percentage of water in which other nutrients present are dispersed. The existence of the colloidal state was first recognized by T
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the Determination of vitamin B 1 Vitamin B 1 is determined by chemical method and microbiological assay. In the chemical method, vitamin B 1 is oxidized in alkaline
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd