Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Is viruses classified as living organism? If yes/no why
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Distribution of body iron in different compartments? In humans, the total quantity of iron in the body varies with haemoglobin concentration, body weight, gender and the
R e troviral method: A retrovirus is a virus that carries its genetic material in the form of RNA rather than DNA. In this method retroviruses are used as vectors to transf
Explain Positive Staining Technique? Here, a stain has a positively charged chromophore that gets attached to the negatively charged outer surface of the microbial cell and thu
Explain the Evolution of the Vascular Plant Body? Vascular Plant anatomy reflects adaptation to life on land. In an aquatic environment, the photosynthetic surfaces are support
What are cytochromes? Cytochromes are proteins of the internal mitochondrial membrane that are specialized in electron transfer and participate in the respiratory chain. Energi
Define the Recommended Dietary Allowance for Vitamin B 12 (RDA)? Vitamin B 12 deficiency is common in true vegans who can be treated with small doses since the daily requirem
1. A pure-breeding black, smooth guinea pig was mated to a pure-breeding white, rough female. They produced several litters, and eventually, five males and twenty females resulted
Long-hair in cats is due to the recessive long-hair allele, l. Black cats (rather than tabbies) are due to the recessive agouti allele, a. A long-haired black female cat has mat
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd