ecology.., Biology

Assignment Help:
write the charecteristics of lake
ecosystem

Related Discussions:- ecology..

What is parasitism, Q. What is parasitism? The Parasitism is the ecolog...

Q. What is parasitism? The Parasitism is the ecological interaction in which a being lives at the expense of another. The parasite often doesn't cause immediate death of the ho

Explain cosmid, Cosmid: The type of artificially constructed vector taken ...

Cosmid: The type of artificially constructed vector taken in use for cloning the 35-45 kb of DNA. These are plasmids carrying the phage l cos site (which permits packaging into l

Explain emtricitabine, Emtricitabine (FTC, Emtriva) Emtricitabine is th...

Emtricitabine (FTC, Emtriva) Emtricitabine is the 5-fluorinated derivative of lamivudine. It has same safetyand efficacy, and can be given once daily. It is available alone or

Explain nutrient requirement and dietary management, Explain Nutrient Requi...

Explain Nutrient Requirement and Dietary Management? You must have understood by the discussion above that by the end of the flow phase, the patient usually is well hydrated an

How coacervates have facilitated emergence of life on earth, How could coac...

How could coacervates have facilitated the emergence of life on earth? Coacervates probably provided a nitid separation between an internal and an external environment and thus

Explain chancroid, Chancroid  Chancroid, caused by Haemophilus ducreyi,...

Chancroid  Chancroid, caused by Haemophilus ducreyi,  is rare in the US. A single dose of azithromycin or ceftriaxone is usually effective, but may be less effective in HIV-inf

Why the av node of a mammalian heart is destroyed, The AV node of a mammali...

The AV node of a mammalian heart is destroyed. A. A depolarization in a cell in the left atrium will cause a depolarization of a cell in the left ventricle. B. The contracti

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What will the responses look like expain, You have a neuron with a resting ...

You have a neuron with a resting potential of -55 mV, EK of -70 mV, and ENa of 50 mV. You decide to voltage clamp the neuron. Now, draw the membrane current over time. What will th

Explain about rna molecules, Explain how early RNA molecules might have bee...

Explain how early RNA molecules might have been able to respond to natural selection. Every RNA molecule might have competed with slightly dissimilar RNA molecules for nucleoti

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd