ecology, Biology

Assignment Help:
importance of pyramid of energy to the ecologist

Related Discussions:- ecology

Explain oleic - linoleic fats, Oleic - Linoleic Fats Fats in this grou...

Oleic - Linoleic Fats Fats in this group are the most abundant. The oils are all of vegetable origin and contain large amounts of oleic and linoleic acids, and less than 20%

Protein synthesis, Protein Synthesis The central dogma of modern bioche...

Protein Synthesis The central dogma of modern biochemistry is totally based on the coded information holds within deoxyribonucleic acid (DNA). Double stranded DNA is converted

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Malpighian tubules, Malpighian Tubules Other arthropods like insects ...

Malpighian Tubules Other arthropods like insects and myriapods and arachnids have Malpighian tubules, the outgrowths of alimentary canal like excretory organs. Malpighian tub

Mammalian testis, Normal 0 false false false EN-IN X-...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Define fermented dairy products-cheese, Normal 0 false false ...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Can mitosis occur in haploid cells, Can mitosis occur in haploid (n) cells?...

Can mitosis occur in haploid (n) cells? And in triploid cells? The mitotic cell division can happen in haploid (n) cells, diploid (2n) cells, triploid (3n) cells, etc. Mitosis

Define precaution-estimation of nitrogen and protein content, Define Precau...

Define Precautions - Estimation of Nitrogen and Protein Content? 1. The apparatus should be airtight to prevent leakage of NH 3 . 2. The tip of the delivery tube should be i

Molecular biology and technology, what are protein? What is the constituent...

what are protein? What is the constituential uni. Of protein? Briefly explain the various forms of protein?

Planeria, differnce between protonephridia and metanephridia

differnce between protonephridia and metanephridia

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd