Ecological isolation, Biology

Assignment Help:

Ecological isolation is based on the fact that population shows preference to one habitat over the other. This extensive forests become barriers to the dispersal of organims living in grasslands. The reverse that priaries being barriers to forest organisms is also true. The red tree mousephenocomys 1ongicaudu.s lives on fir needle trees and feeds on fir needle. It is understandable that for these mice not only priaries but the non-fir forests will also be a barrier for dispersal.

You may recall that in unit of this block we discussed extensively MacArthur's study of five species of warbler birds living in spruce trees. The five species of Dendroica are effectively isolated by ecological factors although they have a similar distribution. As a matter of fact, the ecological and food preference of the different species of warblers are very similar. Under such circumstances one would have expected a severe competition among them. But each species has carved a well defined niche and forages at a particular level in the trees. Differences in breeding dates and occupation of different habitats outside the breeding season are the contributing factors for the minimum competition and niche overlap among the species. There are other instances where potential mates keep away from each other because of their habitat preferences. In these cases there might even be a broad niche overlap and the individuals may exist in the same general area, but the distinctness of sub-species and species is maintained. Dice cited an example from United States where the two sub-species of mice Peromyscus maniculatus have overlapping niches and do not interbreed in nature, although there is interbreeding in the laboratory. Similarly another.study showed that the fresh water and salt water races of the water snake Natrix sipedon may come close together but may not interbreed because of their habitat preferences.


Related Discussions:- Ecological isolation

Define reflection - endodontic surgery, Define Reflection - Endodontic Surg...

Define Reflection - Endodontic Surgery -  Marginal gingival is very delicate and easily injured, therefore you should begin reflection of the vertical incision in the attached

Define the quantitative analysis in nutritional biochemistry, Define the Qu...

Define the Quantitative Analysis in Nutritional Biochemistry? Quantitative analysis involves the measurement of the amount of a substance present. This measurement can be done

Explain 1st type of hypersensitivity, It is IgE mediated hypersensitivity. ...

It is IgE mediated hypersensitivity. Typical manifestations contain asthma, food allergies, eczema, hay fever etc.

Determine the term - neuropsychological screening, Determine the term - neu...

Determine the term - neuropsychological screening examination A neuropsychological screening examination is a considerably abbreviated version of a full neuropsychological ass

Human anatomy-physiology , Human anatomy: Human anatomy is a branch of bio...

Human anatomy: Human anatomy is a branch of biology which, with deals with human physiology and biochemistry. It is mainly concerned with the scientific study of the internal stru

Define regulation of water balance, Define Regulation of Water Balance? ...

Define Regulation of Water Balance? The input of water, as well as, its loss can be highly variable due to individual habits and environmental factors; in spite of this, the to

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define the v2 receptor antagonist, Define the V2 receptor antagonist A ...

Define the V2 receptor antagonist A new drug named ANTI-V2R has been developed that is a V2 receptor antagonist.  When ANTI-V2R binds to a V2 receptor, there is no binding of v

Enumerate the working of mri scanner, Enumerate the working of MRI scanner ...

Enumerate the working of MRI scanner The MRI scanner can be 'tuned' to detect the very subtle disturbances to the magnetic field induced by the different proportions of oxygen

Bohr effect, Bohr Effect Another important influence is the pH. Increa...

Bohr Effect Another important influence is the pH. Increase in carbon dioxide or other acids lowers the pH of plasma and shifts the dissociation curve to the right. At high ca

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd