earth worm, Biology

Assignment Help:
what is mode of nurtion of earth worm/

Related Discussions:- earth worm

What is the aim of specialised assessment, What is the aim of specialised a...

What is the aim of specialised assessment The aim of specialised assessment is often to identify a syndrome and specify its probable basis in abnormal brain function. The basi

Agro industrial-phenolic compounds, Phenolic compounds Gossypol: Gos...

Phenolic compounds Gossypol: Gossypol is a toxic compound found in the cotton plant. It is concentrated in the cottonseed but can also be found in other parts of the cotton

Define observation or inference for fehling's test, Define Observation or I...

Define Observation or Inference for fehling's test? An insoluble reddish brown precipitate of cuprous oxide will be obtained. The reddish brown precipitate indicates the presen

Pharynx and larynx, Pharynx: Pharynx  is a funnel shaped tube about  1...

Pharynx: Pharynx  is a funnel shaped tube about  13cm long that  starts at the internal nares and  extends to the  level of the cricoid cartilage. It  lies posterior  to the n

Explain the stool weight and laxation, Explain the Stool weight and laxatio...

Explain the Stool weight and laxation? The amount of stool excreted varies markedly from individual to individual and in an individual over a period of time. Faeces are complex

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the composition of blood agar, Explain the Composition of Blood Aga...

Explain the Composition of Blood Agar? Infusion from beef heart - 500 gm Tryptose - 10.0 gm Sodium Chloride -  5.0 gm Agar - 15 gm Distilled water - 1000  ml pH

Indications for surgery-pericardial effusion, Pericardial Effusion:  Indica...

Pericardial Effusion:  Indications for Surgery: Pericardial effusion may be the result of peiicarditis due to infection, autoimmune disease or neoplasm. Non-inflammatoly diseases

Explain about the dietary calcium requirements, Explain about the Dietary C...

Explain about the Dietary Calcium Requirements? There are variations in the amount of calcium recommended by different advisory groups. This is mainly due to the different crit

Defects of heart, DEFECT S OF HEART 1 .      Blue Baby syndrome (Cya...

DEFECT S OF HEART 1 .      Blue Baby syndrome (Cyanosis) - Due to persisting foramen ovalis in atrial septum even after birth, the impure blood from right auricles comes to

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd