Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
DRUG DEPENDENCE -
Some drugs are prescribed by doctor for the prevention or treatment of a disease.
Some drugs are used for long periods.
A person becomes addict to these drugs. This is called drug dependence or drug addiction or drug habituation.
Drug dependence is of two types -
(i) Psychological
(ii) Physical
Psychological dependence is a false need.
Physical dependence is a neuro adaptation.
What are the types of cell respiration? There are two types of cell respiration: aerobic cell respiration, a reaction with participation of molecular oxygen (O2), and anaerobic
A disulfide bond can form between any two amino acids that have sulfur in their side-chain.
Define Phosphorous distribution in plasma? In plasma, phosphorus is distributed in different forms. Figure: Phosphorous distribution in plasma Inorg
i want to online research biology projects
If one determines the concentration of cortisol in the blood plasma to be 10 micrograms/mL and that in a 24 hour period a person excretes 10 mgs of cortisol, calculate the volume o
biting mechanism in snakes?
According to the stimuli they collect how are the sensory receptors classified? The sensory receptors are divided according to the stimuli they get: mechanoreceptors are stimul
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Which are the beings that form the kingdom Fungi? The kingdom Fungi is created by fungi. Q. Which are the beings that form the kingdom Plantae? Are algae parts of this k
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd