Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
DRUG DEPENDENCE -
Some drugs are prescribed by doctor for the prevention or treatment of a disease.
Some drugs are used for long periods.
A person becomes addict to these drugs. This is called drug dependence or drug addiction or drug habituation.
Drug dependence is of two types -
(i) Psychological
(ii) Physical
Psychological dependence is a false need.
Physical dependence is a neuro adaptation.
Q. Explain Nutritive and Non-Nutritive Sweeteners? Nutritive Sweeteners: We know some sweeteners like glucose, honey, molasses, fruit juice, dextrose, maltose, mannitol, sorbit
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is AV Block ? First Degree AV Block At rest commonly disappears with exercise owing to the vagal withdrawal. The development of a prolonged PQ segment after exerc
Explain about Listeria monocytogenes infection Listeria monocytogenes is a gram-positive, motile, non-spore forming rod. It is widely distributed in nature and can be found on
What resources are competed for by (a) animals, (b) plants? (a) Animals compete for food, mates and shelter. (b) Plants compete for light, water and minerals.
Damage to the amygdalas may make a pearson fearless. Gleb Shumyatsky's lab reported in an article in Cell (2005) that knock out mice [mice lacking a specific gene] lacking the gene
How to use microorganisms to control diseases
Pre-operative Teaching Brief explanation-anatomy, physiology of the cardio-respiratory system. The disease and the operation which is going to be done. Operati
What are some human diseases caused by bacteria and what are their respective modes of transmission? The major human bacterial infections transmitted by respiratory secretions
Fallopian tube: There are two fallopian tubes connected to the uterus one on each side of it. The ovum released from the ovarian follicle enters the fallopian tube. Th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd