Drug dependence, Biology

Assignment Help:

DRUG DEPENDENCE -

Some drugs are prescribed by doctor for the prevention or treatment of a disease.

Some drugs are used for long periods.

A person becomes addict to these drugs. This is called drug dependence or drug addiction or drug habituation.

Drug dependence is of two types -

(i) Psychological

(ii) Physical

Psychological dependence is a false need.

Physical dependence is a neuro adaptation.


Related Discussions:- Drug dependence

Explain nutritive and non-nutritive sweeteners, Q. Explain Nutritive and No...

Q. Explain Nutritive and Non-Nutritive Sweeteners? Nutritive Sweeteners: We know some sweeteners like glucose, honey, molasses, fruit juice, dextrose, maltose, mannitol, sorbit

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is av block, Q. What is AV Block ? First Degree AV Block At ...

Q. What is AV Block ? First Degree AV Block At rest commonly disappears with exercise owing to the vagal withdrawal. The development of a prolonged PQ segment after exerc

Explain about listeria monocytogenes infection, Explain about Listeria mono...

Explain about Listeria monocytogenes infection Listeria monocytogenes is a gram-positive, motile, non-spore forming rod. It is widely distributed in nature and can be found on

What resources are competed for by animals, What resources are competed for...

What resources are competed for by (a) animals, (b) plants?  (a) Animals compete for food, mates and shelter.  (b) Plants compete for light, water and minerals.

Damage to the amygdalas may make a pearson fearless, Damage to the amygdala...

Damage to the amygdalas may make a pearson fearless. Gleb Shumyatsky's lab reported in an article in Cell (2005) that knock out mice [mice lacking a specific gene] lacking the gene

Microbiology, How to use microorganisms to control diseases

How to use microorganisms to control diseases

Pre-operative teaching in cardiac surgical operation, Pre-operative Teachin...

Pre-operative Teaching Brief explanation-anatomy, physiology of the cardio-respiratory system.  The disease and the operation which is going to be done.  Operati

What are their respective modes of transmission, What are some human diseas...

What are some human diseases caused by bacteria and what are their respective modes of transmission? The major human bacterial infections transmitted by respiratory secretions

Fallopian tube, Fallopian tube: There are two fallopian tubes connec...

Fallopian tube: There are two fallopian tubes connected to the uterus one on each side of it. The ovum released from the ovarian follicle enters the fallopian tube. Th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd