Drinking & driving, Biology

Assignment Help:

DRINKING & DRIVING -

It should not be mixed because alcohol -

1.       Impairs ability to judge distances.

2.       Reduces capacity to coordinate limb muscles.

3.       Makes vision blurred.

4.       Slow responses to unexpected situation.

5.       Changes behaviour, making a person rash, erratic & careless.


Related Discussions:- Drinking & driving

Explain about the whey protein concentrates, Explain about the Whey Protein...

Explain about the Whey Protein Concentrates? You already know that whey is the residual liquid substance that is obtained by separating the coagulum from milk during cheesemaki

Carbon cycle, state 3 ways human activities add carbon to the atmosphere

state 3 ways human activities add carbon to the atmosphere

Quality control of feedstuffs, Quality control of feedstuffs Quality co...

Quality control of feedstuffs Quality control is essential at all stages in the production of compound feed so that animals could get wholesome balanced and nutritious feed. Th

Explain adverse effects of ribavirin, Adverse Effects of Ribavirin  Sys...

Adverse Effects of Ribavirin  Systemic ribavirin has been associated with hemolytic anemia. Oral ribavirin plus interferon appears to cause a higher incidence of cough, pruritu

Structures shared by every chordate, Q What are the three structures shared...

Q What are the three structures shared by every chordate that characterize the group? All beings of the phylum Chordata have branchial clefts in the pharynx in some species pre

Determine the part of the human visual system, Which is the part of the hum...

Which is the part of the human visual system where the receptors that sense light, i.e., the photoreceptor cells, are located? How do those cells work? The photoreceptor cells

What do you mean by hemodialysis, Q. What do you mean by hemodialysis? ...

Q. What do you mean by hemodialysis? Hemodialysis is the artificial blood filtration made by specific machines in alternative of the kidneys. Hemodialysis may be necessary in p

State the method of recombination or crossing-over, Which of the following ...

Which of the following statement is false regarding the method of recombination or crossing-over? A. Crossing-over takes place during prophase I of meiosis B. Recombination

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Biology Question, Why is VeggieTales such a consistently high-quality progr...

Why is VeggieTales such a consistently high-quality program?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd