Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
DRINKING & DRIVING -
It should not be mixed because alcohol -
1. Impairs ability to judge distances.
2. Reduces capacity to coordinate limb muscles.
3. Makes vision blurred.
4. Slow responses to unexpected situation.
5. Changes behaviour, making a person rash, erratic & careless.
1. Biogas is produced by the activity of aerobic bacteria on animal waste 2. Methanobacterium is an aerobic bacterium found in rumen of cattle 3. Biogas, commonly called goba
Dysrhythmias Usually occur during the initial 24-72 hours, but may occur later on also. The causes may be ventricular irritability due to manipulations of heart durin
parasitic adaptations
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What happens to respiratory system in a man going up a hill?
What is Meiosis ? Meiosis starts with a diploid cell and forms four haploid, or 1n, (or "n") germ cells. These n germ cells fuse during fertilization with another germ cell to
Pyramid of Numbers - Ecological Pyramids A graphic representation of the total number of individuals of different species belonging to each trophic level in an ecosystem is kn
Hemerythrins - Respiratory Pigments The Hemerythrins are rather rare. They take place in some animals belonging to the minor phyla like the sipunculid worms, some brachiopods,
Patters of Cleavage In most of the animal groups with spherical or almost spherical egg and little or moderate amount of yolk (micro-or mesolecithal eggs), the first and seco
Contamination due to Pathogens - Water Pollution Sewage is a source of pathogenic viruses, bacteria, worms and other parasites. The extent of contamination by these pathogens
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd