Draw the organic chemistry notation, Biology

Assignment Help:

I know that in organic chemistry notation , it is assumed that the end of a line or the point where two lines meet is a carbon atom and that Hydrogen atoms are not labelled as it is assumed that a hydrogen bonds where available to a Carbon

But what if last carbon end of a a carbon skeleton has only one or two hydrogen instead of the possible three. How does one draw the organic chemistry notation?


Related Discussions:- Draw the organic chemistry notation

Threshold for an action potential in neuron a, Neuron A is a healthy neuron...

Neuron A is a healthy neuron with all the usual ion channels.  When at rest with a membrane voltage of R millivolts, neuron A produces no action potentials.  The voltage thresh

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How to increase in the amount of glucokinase in liver, How to increase in ...

How to increase in  the amount of glucokinase in liver Consumption of a meal rich in carbohydrate  or administration  of insulin initiate an increase in  the amount of glucokin

Explain extra cardiac conduit fontan, Explain Extra Cardiac Conduit Fontan ...

Explain Extra Cardiac Conduit Fontan ? This can be done with or without cardipulmonary bypass. First step is to make a bi-directional Glenn shunt. The main pulmonary artery is

Describe different animal groups, Describe different animal groups a) C...

Describe different animal groups a) Could  comprehensively  compare  and  contrast  the  behaviours  exhibited  by  social animals rather than describe different animal groups

What is the essential morphology of a protozoan cell, Q. What is the essent...

Q. What is the essential morphology of a protozoan cell? Protozoans are eukaryotic cells so they have structures and organelles common to this kind of cell endoplasmic reticula

Cerebellum, what is the work of cerebellum

what is the work of cerebellum

Interior of the left atrium - heart, The left atrium is a thin walled cavit...

The left atrium is a thin walled cavity. Most of the wall is smooth. Musculi pectinati are present only in the auricle of the atrium. The interatrial septum separates the cavity of

Describe the clinical evaluation mvp murmur in details, Describe the Clinic...

Describe the Clinical Evaluation MVP Murmur in details? Characteristic: Mid systolic click followed by a late systolic murmur which usually extends to A2. The click may be abse

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd