Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Double fertilization It carries two sperm cells to the female. A characteristic of angiosperms in which the pollen tube gametophyte in the ovule. The one sperm cell fuses with the egg cell and gives rise to the diploid embryo and the other sperm cell fuses with the two polar cells to form the triploid cell which develops into the endosperm.
Q. Fibre requirement in chronic diarrhoea? Fibre: Insoluble fibre in the form of skins, seeds and structural plant materials should be strictly avoided to minimize on the irrit
Biology : Biology may be defined the study of living organisms. It mainly deals with the characteristics of living organisms and their classification. It is also concerned with the
Population was defined by Clarke in 1954. The term population refers to the total number of individuals of a sp. occupying a particular geographic aera at a given time. A s
Explain the Transport of Amino Acids? More than one transport or carrier system functions in the absorption of amino acids. The active carrier system for neutral amino acids sh
How different are pteridophytes from bryophytes regarding substance transport? Pteridophytes are tracheophyte (vascular) plants, i.e., they have tissues specialized in conduct
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the excretory organ of an agama lizard
Ask In what ways does over gazing lead to soil erosion?
Q. What do you mean by Ventricular Arrhythmias? Considerable disagreement exists regarding the significance of resting ventricular ectopic beats. In study comparing the coronar
gastrulation and its type
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd