Dot blot, Biology

Assignment Help:

Dot blot is the technique for measuring the amount of one perticular DNA or RNA in the highly complex mixture. The samples are spotted onto the hybridization membrane (like nitrocellulose or activated nylon, and many more), fixed and hybridized with the radioactive search. The extent of labeling (as determined by autoradiography and the densitometry) is proportional to concentration of the target molecule in its sample. Standards give the means of calibrating the results. 


Related Discussions:- Dot blot

Define carbohydrates needs in postoperative nutritional care, Define Carboh...

Define Carbohydrates needs in Postoperative Nutritional Care? Carbohydrates ensure the use of protein for tissue synthesis and energy required for increased metabolic demands.

Define vitamins and minerals requirement for cancer patients, Define Vitami...

Define Vitamins, Minerals and Phytochemicals requirement for cancer patients? Several vitamins particularly those of the B-group are essential to promote adequate metabolism of

In what ways does over gazing lead to soil erosion?, Ask In what ways does ...

Ask In what ways does over gazing lead to soil erosion?

How do beings of the class reptilia classify\, Concerning the maintenance o...

Concerning the maintenance of body temperature how do beings of the class Reptilia classify? Like fishes and amphibians, beings of the class Reptilia are heterothermic animals

What is diffusion, Diffusion is the spreading of substance molecules from a...

Diffusion is the spreading of substance molecules from a region where the substance is more concentrated to other region where it is less concentrated. For example, during the boil

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Habitat for the worlds species, Q. Habitat for the worlds species? Natu...

Q. Habitat for the worlds species? Natural ecosystems provide habitat for the world's species. Forests, coral reefs and deep ocean bottoms house many species. Wetlands, through

Explain some precautions for preparation of chloride buffers, Explain some ...

Explain some Precautions for Preparation of Chloride Buffers? 1. Glass electrodes should always be before and after measuring pH with a tissue paper. 2. The pipettes should

Explain the chemotherapeautic rinses, Explain the Chemotherapeautic rinses ...

Explain the Chemotherapeautic rinses Chemotherapeautic rinses:  The use of  0.12  per cent chlorhexidine has been proven to be of therapeutic significance in maintaining period

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd