Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Dot blot is the technique for measuring the amount of one perticular DNA or RNA in the highly complex mixture. The samples are spotted onto the hybridization membrane (like nitrocellulose or activated nylon, and many more), fixed and hybridized with the radioactive search. The extent of labeling (as determined by autoradiography and the densitometry) is proportional to concentration of the target molecule in its sample. Standards give the means of calibrating the results.
Define Carbohydrates needs in Postoperative Nutritional Care? Carbohydrates ensure the use of protein for tissue synthesis and energy required for increased metabolic demands.
Define Vitamins, Minerals and Phytochemicals requirement for cancer patients? Several vitamins particularly those of the B-group are essential to promote adequate metabolism of
Ask In what ways does over gazing lead to soil erosion?
Concerning the maintenance of body temperature how do beings of the class Reptilia classify? Like fishes and amphibians, beings of the class Reptilia are heterothermic animals
Diffusion is the spreading of substance molecules from a region where the substance is more concentrated to other region where it is less concentrated. For example, during the boil
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Habitat for the worlds species? Natural ecosystems provide habitat for the world's species. Forests, coral reefs and deep ocean bottoms house many species. Wetlands, through
Explain some Precautions for Preparation of Chloride Buffers? 1. Glass electrodes should always be before and after measuring pH with a tissue paper. 2. The pipettes should
mcqs
Explain the Chemotherapeautic rinses Chemotherapeautic rinses: The use of 0.12 per cent chlorhexidine has been proven to be of therapeutic significance in maintaining period
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd