Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Dominance - Synthetic Characters
It is a characteristic of vegetation which expresses the predominating influences of one or more species in a stand so that the population of other species is more or less repressed, or is reduced in number and vitality. Dominants are those species which are highly successful in a particular habitat. Cover and population density are the chief qualities determining dominance, but parameters like frequency, height, life form and vitality are also important.
The dominants exercise a controlling influence in the habitat while modifying the microhabitat which permits the growth of many different species which otherwise cannot survive in the absence of dominants. Let us consider an example, a dominant species occurring in pastures, say Cynodon dactylon. It owes its success to excellent vitality, rapid multiplication and growth, possessing deep penetrating root system. All these features make it a dominant species in many grasslands.
Forestry : It concerned with protection or development of forest and to explore the outcome or economic potential of forest. Forestry is the art or science of tree resources, inclu
Define Mobilization of bone calcium and phosphorous? It is now firmly established that vitamin D 3 is metabloized first in the liver to 25-hydroxyvitamin D (25 OH- D) (calcicl
In a word, what process provides the energy for muscle contraction
What are holandric genes? The Holandric genes are genes situated in the nonhomologous region of the Y chromosome. Holandric genes condition phenotypes that emerge only in men s
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
critera for the animal classification
what is the mode of nutrition in tape worm
Q. Acid Hydrolysis of Non-Reducing Sugar? It involves the acid hydrolysis of non-reducing sugars to reducing sugars. It is also known as the process of inversion. Acid hydrolys
You are soon to be registered as a nurse and have applied to work in a unit where you will be caring for a diverse range of clients with medical and surgical complexities. You know
Conventional amphotericin Amphotericin B deoxycholate (Fungizone, and others), the old non-lipid formulation of amphotericin, is by far the least expensive, but the developmen
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd