Dominance - synthetic characters, Biology

Assignment Help:

Dominance - Synthetic Characters

It is a characteristic of vegetation which expresses the predominating influences of one or more species in a stand so that the population of other species is more or less repressed, or is reduced in number and vitality. Dominants are those species which are highly successful in a particular habitat. Cover and population density are the chief qualities determining dominance, but parameters like frequency, height, life form and vitality are also important.

The dominants exercise a controlling influence in the habitat while modifying the microhabitat which permits the growth of many different species which otherwise cannot survive in the absence of dominants. Let us consider an example, a dominant species occurring in pastures, say Cynodon dactylon. It owes its success to excellent vitality, rapid multiplication and growth, possessing deep penetrating root system. All these features make it a dominant species in many grasslands.


Related Discussions:- Dominance - synthetic characters

Forestry, Forestry : It concerned with protection or development of forest ...

Forestry : It concerned with protection or development of forest and to explore the outcome or economic potential of forest. Forestry is the art or science of tree resources, inclu

Define mobilization of bone calcium and phosphorous, Define Mobilization of...

Define Mobilization of bone calcium and phosphorous? It is now firmly established that vitamin D 3 is metabloized first in the liver to 25-hydroxyvitamin D (25 OH- D) (calcicl

Muscle, In a word, what process provides the energy for muscle contraction

In a word, what process provides the energy for muscle contraction

What are holandric genes, What are holandric genes? The Holandric genes...

What are holandric genes? The Holandric genes are genes situated in the nonhomologous region of the Y chromosome. Holandric genes condition phenotypes that emerge only in men s

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Kingdom animalia, critera for the animal classification

critera for the animal classification

Nutrition, what is the mode of nutrition in tape worm

what is the mode of nutrition in tape worm

Acid hydrolysis of non-reducing sugar, Q. Acid Hydrolysis of Non-Reducing S...

Q. Acid Hydrolysis of Non-Reducing Sugar? It involves the acid hydrolysis of non-reducing sugars to reducing sugars. It is also known as the process of inversion. Acid hydrolys

Adapting to health changes in the older adult, You are soon to be registere...

You are soon to be registered as a nurse and have applied to work in a unit where you will be caring for a diverse range of clients with medical and surgical complexities. You know

Explain conventional amphotericin, Conventional amphotericin Amphoteri...

Conventional amphotericin Amphotericin B deoxycholate (Fungizone, and others), the old non-lipid formulation of amphotericin, is by far the least expensive, but the developmen

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd