Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Domestication - Wildlife
It means that man has taken under his direct care the living beings which are useful to him. Through extensive breeding programmes, he has modified them to derive maximum benefit of their products. During the process, the species have lost certain useful characteristics so much so that these forms cannot survive on their own in nature. As very good example is corn, which is pampered so much by man that if it is left on its own, it cannot survive.
Chromosomes with spindle fiber: The kinetochore fibers of spindle attach to the kinetochore region (specialized area in centromere) of chromosome, and align them at the equator of
Describe the Biological parameters of living organisms Biological parameters which include living organisms constitute an important component of soil. Even though organisms fo
Q. Differentiate between adult and infant botulism? • Adult Botulism is prevalent amongst adults whereas Infant Botulism is prevalent in infants of less than one year of age.
What is the difference between a hormone and a morphogen? How do they act and what type of development do they control?
Using Autonomous Transactions The transaction is a sequence of SQL statements that does a logical unit of work. Frequently, one transaction starts the other. In several appl
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
An impermeable membrane separates one liter of a 1M KCl solution in the left compartment from one liter of 1M NaCl solution in the right compartment. At 2 AM today the membrane be
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Characteristics Define Cancer - Hyperplasia Hyperplasia is the extreme proliferation of cells which can be observed in normal as well as cancerous tissues. In normal tissue, a
Name some Drugs to prvent tuberculosis Pyrazinamide can cause morbilliform rash, arthralgias and asymptomatic hyperuricemia, and blocks the hypouricemic action of allopurinol (
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd