Do bacteria cells have a nucleus, Biology

Assignment Help:

Q. Do bacteria cells have a nucleus?

In bacteria the genetic material is dispersed in the cytosol and there is no inner membrane that delimits a nucleus.


Related Discussions:- Do bacteria cells have a nucleus

Why do ribosomes move along mrna during translation, Why do ribosomes move ...

Why do ribosomes move along mRNA during translation? During translation the ribosome always exposes two mRNA codons to be translated by moving along the mRNA. When a peptide bo

Protozoa, which symbiotic protozoa present in digestive tract of termites?

which symbiotic protozoa present in digestive tract of termites?

What are some examples of biological activities, Q. What are some examples ...

Q. What are some examples of biological activities in which osmosis plays an significant role? Hemolysis destruction of red blood cells by entrance of water, the hydric regulat

What is the inactivation of the x chromosome?what is a barr, What is the in...

What is the inactivation of the X chromosome? What is a Barr body? The Inactivation of the X chromosome is a phenomenon that occurs in women. Ever since women have two X chromo

Similaritie and difference between lamarckism and darwinism, What are the f...

What are the fundamental similarities and differences between lamarckism and darwinism? Both darwinism and lamarckism are evolutionary theories as opposed to fixism, both admit

What is an evolutionary explanatory hypothesis, Q. What is an evolutionary ...

Q. What is an evolutionary explanatory hypothesis for the secretion by the heart of a hormone that regulates the renal function? Which is that hormone? The renal regulator horm

Determine the categories of latent squint, Determine the categories of Late...

Determine the categories of Latent squint Latent squint category there are five subtypes: 1)  Esophoria 2)  Exophoria 3)  Hypophoria 4)  Hyperphoria 5)  Cyclopho

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Cell biology, explain in detail the cell theory and it exceptions

explain in detail the cell theory and it exceptions

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd