Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The DNA replication is a biological procedure which happens in all living organisms and copies their DNA; it is the basis for biological inheritance. The process will starts when one double-stranded DNA molecule generates two identical copies of the molecule. Cell cycle mitosis also pertains to the DNA replication or reproduction process. The cell cycle involves interphase, prophase, metaphase, anaphase and telophase. Each strand of the original double-stranded DNA molecule serves as sample for the production of the complementary strand a procedure referred to as semiconservative repetition. The Cellular proofreading and error toe-checking mechanisms make sure near ideal fidelity for DNA replication.
An experiment supported by NASA calculated the heights of 6 men rapidly before going to bed, and then again after 3 days of bed rest. The data were as follows: What is the 95% con
Question 1: Explain the importance of Human Genome Project in Research and list the different methods available for Gene sequencing Mention the importance of Human Genome
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Which is the brain region responsible for the coordination and equilibrium of the body? In the central nervous system the cerebellum is the main controller of the motor coordin
Limb Regeneration in Amphibians In vertebrates, the amphibians particularly the urodeles comprise spectacular power of regeneration. This power of regeneration has made them
Explain in brief about the Cell Membrane All cells, whether prokaryotic or eukaryotic, are bound by a limiting membrane called the cell membrane or the plasma membrane. The ce
give detail account of modes of locomotion in protozoa and describe various type of asexual reproduction in protozoa
Explain the Stages In Taxonomic Procedures? Divided into three levels or phases: 1) Alpha (α) phase, 2) Beta (β) phase, 3) Gamma (γ) phase. Alpha Taxonomy The
When conducting a hair comparison, what factors would you consider?
What is the structural flat representation of an amino acid molecule? An amino acid has a central carbon to which a carboxyl group binds on a side and to which a -R (variable r
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd