Dna replication in bacteria, Biology

Assignment Help:

The DNA replication is a biological procedure which happens in all living organisms and copies their DNA; it is the basis for biological inheritance. The process will starts when one double-stranded DNA molecule generates two identical copies of the molecule. Cell cycle mitosis also pertains to the DNA replication or reproduction process. The cell cycle involves interphase, prophase, metaphase, anaphase and telophase. Each strand of the original double-stranded DNA molecule serves as sample for the production of the complementary strand a procedure referred to as semiconservative repetition. The Cellular proofreading and error toe-checking mechanisms make sure near ideal fidelity for DNA replication.

 


Related Discussions:- Dna replication in bacteria

Experiment supported by nasa , An experiment supported by NASA calculated t...

An experiment supported by NASA calculated the heights of 6 men rapidly before going to bed, and then again after 3 days of bed rest. The data were as follows: What is the 95% con

Explain the importance of human genome project, Question 1: Explain the...

Question 1: Explain the importance of Human Genome Project in Research and list the different methods available for Gene sequencing Mention the importance of Human Genome

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Which is the brain region responsible for the coordination, Which is the br...

Which is the brain region responsible for the coordination and equilibrium of the body? In the central nervous system the cerebellum is the main controller of the motor coordin

Limb regeneration in amphibians, Limb Regeneration in Amphibians In v...

Limb Regeneration in Amphibians In vertebrates, the amphibians particularly the urodeles comprise spectacular power of regeneration. This power of regeneration has made them

Explain in brief about the cell membrane, Explain in brief about the Cell M...

Explain in brief about the Cell Membrane All cells, whether prokaryotic or eukaryotic, are bound by a limiting membrane called the cell membrane or the plasma membrane. The ce

Zoology, give detail account of modes of locomotion in protozoa and describ...

give detail account of modes of locomotion in protozoa and describe various type of asexual reproduction in protozoa

Explain the stages in taxonomic procedures - alpha taxonomy, Explain the St...

Explain the Stages In Taxonomic Procedures? Divided into three levels or phases: 1) Alpha (α) phase, 2) Beta (β) phase, 3) Gamma (γ) phase. Alpha Taxonomy The

When conducting the hair comparison, When conducting a hair comparison, wha...

When conducting a hair comparison, what factors would you consider?

What is the structural flat representation of an amino acid, What is the st...

What is the structural flat representation of an amino acid molecule? An amino acid has a central carbon to which a carboxyl group binds on a side and to which a -R (variable r

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd