Dna replication in bacteria, Biology

Assignment Help:

The DNA replication is a biological procedure which happens in all living organisms and copies their DNA; it is the basis for biological inheritance. The process will starts when one double-stranded DNA molecule generates two identical copies of the molecule. Cell cycle mitosis also pertains to the DNA replication or reproduction process. The cell cycle involves interphase, prophase, metaphase, anaphase and telophase. Each strand of the original double-stranded DNA molecule serves as sample for the production of the complementary strand a procedure referred to as semiconservative repetition. The Cellular proofreading and error toe-checking mechanisms make sure near ideal fidelity for DNA replication.

 


Related Discussions:- Dna replication in bacteria

Denitrifying bacteria play in the nitrogen cycle, What part do (a) nitrifyi...

What part do (a) nitrifying, (b) nitrogen-fixing and (c) denitrifying bacteria play in the nitrogen cycle? a) Nitrifying bacteria in the soil change ammonia and other nitrogeno

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the lateral lines of fishes, What are the lateral lines of fishes?...

What are the lateral lines of fishes? The lateral lines of bony fishes are sense organs that extend along both sides of the animal body. They make contact with the environment

What do you know by hemodynamic responses, Q. What do you know by Hemodynam...

Q. What do you know by Hemodynamic Responses? Reduced exercise capacity roughly reflects impaired LV function, and may contribute its prognostic value to this association. Comp

Explain soybean protein, Explain soybean protein The need for the devel...

Explain soybean protein The need for the development of soybean protein concentrates stemmed primarily from two considerations: to enhance protein concentration and to improve

Why we use histamine in consciousness, Q. Why we use Histamine in conscious...

Q. Why we use Histamine in consciousness? Histamine is involved in controlling the level of consciousness during waking. The level of histamine diminishes during sleep and its

Precautions for selective and differential medium, Precautions for Preparat...

Precautions for Preparation of Selective and Differential Medium 1. Dissolve ingredients one by one. 2. Check and set the medium to appropriate pH. 3. Autoclave the mediu

Define factors that lead to vitamin k deficiency, Define Factors that Lead ...

Define Factors that Lead to Vitamin K Deficiency? The factors that lead to vitamin K deficiency include: 1) Marginal dietary intake if one undergoes trauma and extensive sur

Invertebrate zoology, give an example invertebrate phylum/phyla for protopl...

give an example invertebrate phylum/phyla for protoplasmic grade organization

Discuss about dengue and aids, Why is it difficult to produce efficient vac...

Why is it difficult to produce efficient vaccines against a viral infection like dengue and AIDS? It is complex to make vaccines against dengue because there are four dissimila

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd