Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The DNA replication is a biological procedure which happens in all living organisms and copies their DNA; it is the basis for biological inheritance. The process will starts when one double-stranded DNA molecule generates two identical copies of the molecule. Cell cycle mitosis also pertains to the DNA replication or reproduction process. The cell cycle involves interphase, prophase, metaphase, anaphase and telophase. Each strand of the original double-stranded DNA molecule serves as sample for the production of the complementary strand a procedure referred to as semiconservative repetition. The Cellular proofreading and error toe-checking mechanisms make sure near ideal fidelity for DNA replication.
What part do (a) nitrifying, (b) nitrogen-fixing and (c) denitrifying bacteria play in the nitrogen cycle? a) Nitrifying bacteria in the soil change ammonia and other nitrogeno
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the lateral lines of fishes? The lateral lines of bony fishes are sense organs that extend along both sides of the animal body. They make contact with the environment
Q. What do you know by Hemodynamic Responses? Reduced exercise capacity roughly reflects impaired LV function, and may contribute its prognostic value to this association. Comp
Explain soybean protein The need for the development of soybean protein concentrates stemmed primarily from two considerations: to enhance protein concentration and to improve
Q. Why we use Histamine in consciousness? Histamine is involved in controlling the level of consciousness during waking. The level of histamine diminishes during sleep and its
Precautions for Preparation of Selective and Differential Medium 1. Dissolve ingredients one by one. 2. Check and set the medium to appropriate pH. 3. Autoclave the mediu
Define Factors that Lead to Vitamin K Deficiency? The factors that lead to vitamin K deficiency include: 1) Marginal dietary intake if one undergoes trauma and extensive sur
give an example invertebrate phylum/phyla for protoplasmic grade organization
Why is it difficult to produce efficient vaccines against a viral infection like dengue and AIDS? It is complex to make vaccines against dengue because there are four dissimila
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd