diversity, Biology

Assignment Help:
Importance of diversity

Related Discussions:- diversity

Explain about maple syrup urine disease, Q. Explain about Maple Syrup Urine...

Q. Explain about Maple Syrup Urine Disease? Maple Syrup Urine Disease (MSUD) is a group of inherited metabolic disorders of three branched chain amino acids (BCAA) namely leuci

What is deuterostome. explain in brief., What is Deuterostome. Explain in b...

What is Deuterostome. Explain in brief. Phyla, including the Chordata and Echinodermata which share common characteristics of blastopore-not forming the mouth, radial indetermi

What are varices, What are varices? Why are they more common in the inferio...

What are varices? Why are they more common in the inferior limbs? Varix means abnormal enlargement of veins. Varices happen when excessive pressure against the normal blood fl

Explain photosynthetic prokaryotes and mitochondria, What evidence strength...

What evidence strengthens the hypothesis that chloroplasts could have been photosynthetic prokaryotes and mitochondria could have been aerobic prokaryotes? In fact that the chl

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the importance of vitamin k, What is the Importance of Vitamin K ...

What is the Importance of Vitamin K The site of action of vitamin K activity is the highly complex mechanism of blood coagulation. Due to its effect on prothrombin, vitamin K i

Testes (testicles), TESTE S (TESTICLES) - 2 in number (Diarchic). P...

TESTE S (TESTICLES) - 2 in number (Diarchic). Pinkish in colour. Oval shaped. 4-5 cms long, 2.5 cm wide and 3 cm thick. Mesodermal. In embryonic stage attached to kid

Systematics, three types of evidence used by systematic taxonomists

three types of evidence used by systematic taxonomists

Pyramid of numbers - ecological pyramids, Pyramid of Numbers - Ecological P...

Pyramid of Numbers - Ecological Pyramids A graphic representation of the total number of individuals of different species belonging to each trophic level in an ecosystem is kn

Basic morphological features of echinoderms, Q. What are the basic morpholo...

Q. What are the basic morphological features of echinoderms? Echinoderms, as the name indicates (derma = skin, echino = spiny), are creatures with spines originated from an end

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd