Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Explain about Maple Syrup Urine Disease? Maple Syrup Urine Disease (MSUD) is a group of inherited metabolic disorders of three branched chain amino acids (BCAA) namely leuci
What is Deuterostome. Explain in brief. Phyla, including the Chordata and Echinodermata which share common characteristics of blastopore-not forming the mouth, radial indetermi
What are varices? Why are they more common in the inferior limbs? Varix means abnormal enlargement of veins. Varices happen when excessive pressure against the normal blood fl
What evidence strengthens the hypothesis that chloroplasts could have been photosynthetic prokaryotes and mitochondria could have been aerobic prokaryotes? In fact that the chl
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the Importance of Vitamin K The site of action of vitamin K activity is the highly complex mechanism of blood coagulation. Due to its effect on prothrombin, vitamin K i
TESTE S (TESTICLES) - 2 in number (Diarchic). Pinkish in colour. Oval shaped. 4-5 cms long, 2.5 cm wide and 3 cm thick. Mesodermal. In embryonic stage attached to kid
three types of evidence used by systematic taxonomists
Pyramid of Numbers - Ecological Pyramids A graphic representation of the total number of individuals of different species belonging to each trophic level in an ecosystem is kn
Q. What are the basic morphological features of echinoderms? Echinoderms, as the name indicates (derma = skin, echino = spiny), are creatures with spines originated from an end
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd