Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Disease Control and Prevention reports:
Body Mass Index is a reliable indicator of body fat for most children and teens. BMI is calculated from a child's weight and height is used as an easy-to-perform method of screening for weight categories that may lead to health problems.. For children and teens, BMI is age and sex specific and is often referred to as BMI for age.
The Center for Disease Control and Prevention reports BMI for age growth charts for girls as well as boys to obtain a percentile ranking. Percentiles are the most commonly used indicator to assess the size and growth pattern of individual children in the United States.
The following table provides weight status categories and the corresponding percentiles and BMI range for 10 year old boys in the United States.
Health officials of a Midwestern town are concerned about the weight of children in their town. For example, they believe the BMI of their 10 year old boys is normally disrtubuted with the mean 19.2 and standard deviation 2.6
In a report, use the following information to
1.) Compute the proportion of 10 year old boys in this town that are in the various weight status categories given the BMI ranges.
2.) Discuss whether the concern of health officials is justified,
Weight Status Category
Percentile Range Category
BMI Range
Underweight
Less than 5th
Less than 14.2
Healthy Weight
Between 5th and 85th
Between 14.2 and 19.4
Overweight
Between 85th and 95th
Between 19.4 and 22.2
Obese
More than 95th
More than 22.2
Success which signifies Optimum Health The features or clinical conditions which are representative of this group are: i) No pain or tenderness in the implant upon function.
State two ways in which sulphur dioxide emissions from coal-fired generating stations could be reduced. Sulphur dioxide emissions can be reduced by fitting desulphurization pl
The AV node of a mammalian heart is destroyed. A. A depolarization in a cell in the left atrium will cause a depolarization of a cell in the left ventricle. B. The contracti
A In taxonomy, what is a "KEY" ? List the different types of keys. How are they prepared and what are they used for ?sk question #Minimum 100 words accepted#
Define the Qualitative Technique in Nutritional Biochemistry? In this manual you will be familiarized with simple qualitative techniques and tests to identify compounds such as
Trout beck zone - Lotic Ecosystem This is larger and more constant than the head stream. The greater volume of torrential water carves channels into exposed rock floor (bed ro
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Explain Lane Eynon Method procedure? You will be carrying out the procedure in two steps using Lane Eynon Method. Step 1 It involves the standardization of copper s
Nursing Care and Treatment The only treatment is surgical repair and child may be operated before 18 months as per the choice of surgeon so that speech pattern of child may
Why does one need to study about soil and what is its importance? You would be aware that, from the dawn of agriculture, cultivators were attracted to fertile soils of river
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd