Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
At 1 AM, a healthy squid giant axon is placed in a bath of normal squid physiological extracellular saline and is internally perfused with normal squid intracellular saline.
Its resting potential at 1:55 AM is -70 millivolts. For this question, ignore any possible effects due to the sodium-potassium pump. At 2 AM, there is a change in the
A. intracellular perfusion fluid so that its concentration of potassium ion is decreased. This will cause an increase in the resting membrane voltage.
B. extracellular saline so that its concentration of potassium ion is decreased. This will cause a increase in the Nernst equilibrium potential for potassium ion.
C. intracellular perfusion fluid so that its concentration of potassium ion is increased. This will cause a decrease in the Nernst equilibrium potential for potassium ion.
Define Factors Which May Lead To Errors in Count? There are many factors, which may lead to errors in count. (i) Counts may be low if the agar medium used in the technique d
Classic Repair (Linear repair) : The operation is done under cardio pulmonary bypass, through median sternotomy. If additional CABG is required, conduit harvesting is done.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Elaborate the following term in detail - Macronucleus. One of two types of dimorphic nuclei found in ciliate protozoans. Macronucleus contains multiple copies of genome (polypl
What is an analogy for a smooth endoplasmic reticulum? Endoplasmic reticulum (ER) is such as a manufacturing plant, like a factory, where proteins and lipids are made. This is
Explain the Staphylococcus - Characteristics of Bacteria? Staphylococcus - It is gram positive, nonsporulating facultative anaerobic cocci present in grape-like clusters. These
Enumerate about the diseases Insomnia The results from studies of people, who claim that they do not sleep, or wake up frequently from sleep show that their insomnia can have m
Which of the following is a false statement regarding Polymerase Chain Reaction (PCR)? A. PCR is a modified version of cellular replication that is used to amplify small amount
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Q. Are hormones only proteins? Some hormones are proteins, like glucagon, insulin and ADH others are derived from proteins (modified amino acids) like noradrenaline and adrenal
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd