Discuss about human ears, Biology

Assignment Help:

Ears

We have a pair of ears. Each ear has three parts - external, middle and inner ear. The function of the middle ear is transmission of sound waves from external to inner ear.

 


Related Discussions:- Discuss about human ears

Qualitative changes, Qualitative Changes The qualitative changes in th...

Qualitative Changes The qualitative changes in the structure of proteins in response to stress can lead to the following: Resistance against denaturation of prote

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What do you mean by proteinuria, Q. What is proteinuria? Why is proteinuria...

Q. What is proteinuria? Why is proteinuria a sign of glomerular renal injury? Proteinuria means losing of proteins through urine under normal conditions proteins are too big to

Explain process to maintain the quality of frying oil, Maintaining the qual...

Maintaining the quality of frying oil  As frying continues, the level of oil in the fryer depletes. There are two beneficial frying fat quality factors affected during the fryi

Salts responsible for the cellular osmotic regulation, Q. What are the majo...

Q. What are the major mineral salts responsible for the cellular osmotic regulation? The main ions that act in the regulation of the osmotic pressure in tissues and cells are t

How different is the gametogenesis in men and in women, Q. Concerning event...

Q. Concerning events during the periods of life how different is the gametogenesis in men and in women? The formation of spermatogonia in men takes place during the embryonic p

Hydrogen bonds important for making water cohesive liquid, Hydrogen bonds a...

Hydrogen bonds are important for all of the following except:: a) Allowing carbohydrates to dissolve in water b) Stabilizing the three-dimensional shape of proteins. c) Ma

Name the nitrogenous waste excreted in the larval, What benefit does the se...

What benefit does the sea anemone get in the sea anemone-hermit crab facultative mutualism? Give an alternative term for this part of mutualism. Name the nitrogenous wast

Determine the factors that affecting food choice, Determine the Factors tha...

Determine the Factors that Affecting Food Choice? As a dietician, it is necessary to understand how our food choices are affected. Every day we make food choices which influenc

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd