Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Disaccharides can be understood as follows 1.Sugars made up of the two monosaccharides held together by the covalent bond; like sucrose and lactose. 2. Type of sugar (saccharide) composed of the two sugar molecules bonded together with the ester (covalent) bond for instancemaltose, sucrose, and lactose.
Explain the stages in taxonomic procedures - Beta Taxonomy This stage is also known as macro taxonomy or synthesis taxonomy. At this level the species are arranged or classifie
Explain the stages in taxonomic procedures - Gamma Taxonomy This phase of taxonomy is also called biological taxonomy and is concerned with the study of speciation. It is inclu
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Vitamins differ from minerals in that vitamins are compounds, and not elements. Vitamins do not help form bodily structures and thus are needed strictly in small quantities-sometim
Golgi complex is the organelles in animal cells having a sequence of þattened sacs which sort, chemically modify, and package proteins produced on the rough endoplasmic reticulum.
Drosophila has 4 bivalents (homologous chromosomes) formed at Meiosis I. How many chromosomes and chromatin strands are present in each of the following stages- Anaphase of mito
Mechanism of Cleavage Such as the mitotic division in any cell, cleavage is the result of two events: mitotic nuclear division (Karyokinesis) followed via cytoplasmic divisio
What is an open circulatory system? Open circulatory system is the one in which blood does not circulate only in blood vessels but it also falls in cavities that irrigate tissu
Biogeochemical Cycling - Nutrient Cycles The energy flows through ecosystems enabling the organisms to perform various kinds of work, and is ultimately lost as heat. It is gon
Avian influenza The etiological a gentisa via ninfluenz a type A virus und e r the family Orthomyxoviridae. Avian influenza pandemics in Pakistan, Nepal and Myanamar (1995) and
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd