Disaccharides, Biology

Assignment Help:

DISACCHARIDES

  • They are oligosaccharides composed of two monosaccharide residues .
  • Three common disaccharides are   sucrose (glucose + fructose) = cane suger maltose (glucose + glucose) = malt sugar lactose (glucose + galactose) = milk sugar
  • Common formula is Cn(H2O)n-1.

SUCROSE

  • Commercial or Table sugar.
  • Obtained from stems of Sugarcane (Saccharum officinarum) and roots of Beet sugar (Beta vulgaris).
  • Sucrose is a non-reducing sugar.
  • Sweetness index of sucrose is 100.
  • Formed of two molecules each of glucose and fructose.
  • It has neither aldehyde group nor keto group.

MALTOSE

  • Malt Sugar
  • It is a disaccharide formed of two molecules of glucose which are connected to each other through the a -1, 4 D-glycosidic linkage.
  • It is present in Barley.
  • Maltose is formed during hydrolysis of starch.
  • It is found in germinating cereals.
  • The sugar is present in malt, and is therefore, also called malt sugar.
  • Sweetness index is 30.
  • Maltose is a reducing surgar.

LACTOSE

  • Milk Sugar.
  • It is a disaccharide sugar present in milk upto the extent of 5%.
  • Lactose is formed of D-galactose and D-glucose, both in pyranose state, through the b-1, 4 glycocydic bond.
  • The monosaccharide galactose is also synthesised from glucose inside the mammary glands.
  • Sweetness index of lactose is 16.
  • Like maltose, lactose is a reducing sugar.
  • Souring of milk occurs when bacteria convert lactose into lactic acid.
  • Present only in mammals.

TREHALOSE

  • It is a disaccharide sugar made of two glucose residues which was originally obtained from cocoon of Trehela (weevil Larinus species) as sweetening agent.
  • Trehalose is found in haemolymph of some insects and fungi including yeast.

Related Discussions:- Disaccharides

Green leaves give off oxygen in sunlight, Green leaves give off oxygen in s...

Green leaves give off oxygen in sunlight Place some water weed under a funnel in a beaker of water reverse a test tube full of water over the tube of the funnel. Leave the appa

Define the techniques of instrument retrieval, Define the Techniques of Ins...

Define the Techniques of Instrument Retrieval Endo Extractor (Brasseler) a. Hollow tube bonded to coronal tip of separated instrument by cyanoacrylate adhesive, with

Absorption of amino acids and peptides, Absorption of amino acids and  pep...

Absorption of amino acids and  peptides Generally,  the  dietary proteins are almost comp!etely  digested to their constituent amino acids and these are rapidly absorbed  from

Argument, do you can write argument i will send you the article you want wr...

do you can write argument i will send you the article you want write from with rules please call me at 623-552-8532

Why do preserved foods not spoil, Why do preserved foods not spoil? Pla...

Why do preserved foods not spoil? Plant and animal cells must stay in an isotonic, or neutral, solution to survive. When salt or sugar is added, more of the cells wither and di

Describe the rationale behind sterilization, Q. Describe the rationale behi...

Q. Describe the rationale behind sterilization? Rationale for sterilization: Source of potential infection that exists in dental office include hands, saliva, nasal secretion,

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain microbiology of vegetables, Q. Explain Microbiology of vegetables? ...

Q. Explain Microbiology of vegetables? Ans. All of us are well aware that vegetables are grown in soil, which, we already know, are a rnajor support system for the mi

Health insurance and its interaction with medical market, Normal 0 ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd