Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Dinoflagellates are single-celled to colonial protistans characterized by the two flagella, one girdling cell and the other trailing the cell. Some of the dinoflagellates exist in coral, in a symbiotic association. These dinoflagellates are termed as the zooxanthellae. Other dinoflagellates happen in such high numbers that the water is colored red, a phenomenon is called as a red tide.
functions of arteries in mammals
What evidence strengthens the hypothesis that chloroplasts could have been photosynthetic prokaryotes and mitochondria could have been aerobic prokaryotes? In fact that the chl
Define the Obesity in Children? It is difficult to measure overweight or obesity in children and adolescents because they grow and mature at different rates. Weight status in c
If levels of ATP become high in a cell (i.e more than the cell needs at that time), describe the mechanism that the cell would use to alleviate this situation (include the name of
Airway: Place the patient supine on a firm surface with his head at level or slightly lower than the level of heart. Immediately, clear the airway and start rescue brea
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Isolated fibre required for diabetes patient? Isolated fibre: It is generally recommended that diabetics should substitute whole wheat flour with soya flour, whole Bengal f
As in several fields of molecular biology studies of E. coli have gives the model for subsequent investigations of transcription in eukaryotic cells. The basic mechanisms by that t
What is Infra-diaphragmatic Type of TAPVC? Initial stages of operation are the same as for supracardiac type of TAPVC. The heart is lifted out of the pericardial cavity and c
Define colonization of the gut - probiotic effect? It is not clear how probiotics influence the flora and produce a beneficial effect. However, colonization of the gut appears
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd