Dinoflagellates, Biology

Assignment Help:

Dinoflagellates are single-celled to colonial protistans characterized by the two flagella, one girdling cell and the other trailing the cell. Some of the dinoflagellates exist in coral, in a symbiotic association. These dinoflagellates are termed as the zooxanthellae. Other dinoflagellates happen in such high numbers that the water is colored red, a phenomenon is called as a red tide.


Related Discussions:- Dinoflagellates

Explain photosynthetic prokaryotes and mitochondria, What evidence strength...

What evidence strengthens the hypothesis that chloroplasts could have been photosynthetic prokaryotes and mitochondria could have been aerobic prokaryotes? In fact that the chl

Define the obesity in children, Define the Obesity in Children? It is d...

Define the Obesity in Children? It is difficult to measure overweight or obesity in children and adolescents because they grow and mature at different rates. Weight status in c

Describe the mechanism use to alleviate situation, If levels of ATP become ...

If levels of ATP become high in a cell (i.e more than the cell needs at that time), describe the mechanism that the cell would use to alleviate this situation (include the name of

Breathing and airway - initiation of cpr, Airway: Place the patient  s...

Airway: Place the patient  supine on a firm  surface with his  head at level  or  slightly lower than the level of heart. Immediately, clear the  airway and start  rescue brea

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Isolated fibre required for diabetes patient, Q. Isolated fibre required fo...

Q. Isolated fibre required for diabetes patient? Isolated fibre: It is generally recommended that diabetics should substitute whole wheat flour with soya flour, whole Bengal f

Transcription in prokaryotes, As in several fields of molecular biology stu...

As in several fields of molecular biology studies of E. coli have gives the model for subsequent investigations of transcription in eukaryotic cells. The basic mechanisms by that t

What is infra-diaphragmatic type of tapvc, What is Infra-diaphragmatic Type...

What is Infra-diaphragmatic Type of TAPVC? Initial stages of operation are the same as for supracardiac type of TAPVC. The heart is lifted out of the pericardial cavity and c

Define colonization of the gut - probiotic effect, Define colonization of t...

Define colonization of the gut - probiotic effect? It is not clear how probiotics influence the flora and produce a beneficial effect. However, colonization of the gut appears

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd