Digestive system - liver, Biology

Assignment Help:

LIVER (HEPAR) -

  1. Largest gland of body. Weighing 1.6 kg. Form 1/40 of the body weight. Bio-chemical laboratory.
  2. Bussiest part in whole river of life. Dark reddish brown in colour.
  3. Situated on right side attaches to posterior concavity of diaphragm by a fold of peritonium i.e. Falciparum ligament.
  4. Bile juice is synthesized and secreted by cholerosis.
  5. It is made up of 4 lobes- right lobe, left lobe, quadrate & caudata lobe. (In rabbit 5 lobes).
  6. On right central lobe gall bladder is situated. Gall bladder stores bile juice.
  7. Its basal part is fundus. Its duct is cystic duct.
  8. Gall bladder is absent in rodent, cetacean & parissodactyla.
  9. Stone in gall bladder is cholycystosis due to more concentration of cholesterol which causes crystalization.
  10. Each lobe is made up of numerous lobules. Structure of each lobule is similar.
  11. It is surrounded by Glisson's capsule.
  12. Lobule is made up hepatic cells which form radially arranged hepatic cords.
  13. Between two hepatic cords blood sinuoids present.
  14. On periphery Kupffer's cells present, phagocytic in nature.
  15. On each corner of lobule portal traid present in which hepatic artery interlobular vein (part of hepatic portal sy.) & bile duct present. In hepatic cell conaliculli present.
  16. All canaliculi open into Hering's canal which form bile duct.
  17. Hepatic artery and inter labular vein supply blood to liver.
  18. Blood is collected from lobule by large central singel intralobular vein.

2411_liver.png


Related Discussions:- Digestive system - liver

Hydra, hydra has what symmetry......radial or biradial????

hydra has what symmetry......radial or biradial????

Determine the cylindrical body of nematodes brought, Compared to platyhelmi...

Compared to platyhelminthes which physiological problem have the cylindrical body of nematodes brought? How was that problem solved? The cylindrical shape of nematodes made imp

What is the photoperiod, What is the photoperiod? The Photoperiod is th...

What is the photoperiod? The Photoperiod is the daily time period of light exposure of a living being and the photoperiod may differ according to the period of the year.

Set them up using the punnett square, Two gene loci, A and B, assort indepe...

Two gene loci, A and B, assort independently, and alleles A and B are dominant over alleles a and b. Indicate the probability of producing: An aB phenotype from a cross AaBb x AaBB

Explain monascus species, Explain Monascus species Most of the reports ...

Explain Monascus species Most of the reports of food colourants from microbial sources involve Monascus species, particularly Monascus purpureus, followed by  Rhodotorula speci

Concepts and definitions in relation to nutrient requirement, Concepts and ...

Concepts and Definitions in Relation to Nutrient Requirements 1) The probability concept describes the relationship between the levels of intake and the probability of risk of

Define clinical feature and medical complication for bulimia, Define Clinic...

Define Clinical Features and Medical Complications for bulimia? Unlike, anorexia nervosa, in bulimia you will find that symptoms are more difficult to detect because patients a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

History of viruses, In the early days of microbiology, the disease producin...

In the early days of microbiology, the disease producing submicroscopic agents were termed as 'filterable viruses' because of their ability to pass through conventional filters whi

Greenfields hollow implant, In 1906, Greenfield described the fabrication a...

In 1906, Greenfield described the fabrication and insertion of an endossoeus implant. He for the first time, used a basket shaped, round, hollow implant made of an iridium-platinu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd