Digestive system - buccal cavity, Biology

Assignment Help:

BUCCAL CAVITY -

Situated between upper & lower jaw. It is lined by stratified squamous epithelium.
Separated from nasal chamber by palate. Palate forms roof of buccal cavity.
Palate is modification of premexilla, maxilla and palatine bones.
Anterior palate is hard palate due to palatine ridges or rugae.
Posterior palate is soft palate without rugae, in the end it forms UVULA or Velum peleti.
Uvula is made up of connetive tissue & muscles.
Close to velum peleti in pharyangeal wall 6 tonsils present.
Tonsils are made up of lymphoid tissue, commonly known as guard of body.
Tonsils are arranged in the form of a ring. The ring of tonsils is called Waldeyer's ring.
The tonsils present in man are - nasopharyngeal tonsils, tubal tonsils, paltine tonsils and lingual tonsils.

Related Discussions:- Digestive system - buccal cavity

What is enteral feeding, Tube or Enteral Feeding Ideally the patient mu...

Tube or Enteral Feeding Ideally the patient must be fed orally, but in cases where the patient is unable to take solid foods, a part or all of intake is usually given by the tu

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain phylum cyanobacteria, Phylum Cyanobacteria Cyanobacteria are p...

Phylum Cyanobacteria Cyanobacteria are prokaryotes, but they are not like bacteria in the usual sense of the word. The cyanobacteria lack chloroplasts, and their l

Types of insulin, There are different types of insulin available and prescr...

There are different types of insulin available and prescribed by the doctor according to the need of the patient. Insulin is grouped according to the speed of action in the body i.

Fungal diseases - aspergillosis, F u n g a l diseases A spergill...

F u n g a l diseases A spergillosis Aspergillosis is mycotic disease of poultry and all other species of birds caused by a fungus known as Aspergillus fumigatus . F

How does the heart impel the blood, Q. How does the heart impel the blood? ...

Q. How does the heart impel the blood? The heart is a muscular organ that contains chambers right ventricle and right atrium right ventricle and and left atrium through which b

Ecology, What is the concept of minimum and maximum way of tolerance

What is the concept of minimum and maximum way of tolerance

Define basic function of secretin in the digestive process, Q. Where is it ...

Q. Where is it produced and what is the function of secretin in the digestive process? Secretin is made in the duodenum the chyme acidity causes the duodenum to release this ho

Phytoplankton stage - hydrarch, Phytoplankton Stage - Hydrarch In this...

Phytoplankton Stage - Hydrarch In this initial stage, the pond water is poor in nutrients and is devoid of much life. At this stage, the water is incapable of supporting large

Hypothermia, Hypothermia As the blood passes through the oxygenato...

Hypothermia As the blood passes through the oxygenator, hypothermia machine allows the blood to cool to the required temperature. Generally, the temperature is brought dow

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages