Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Diffusion of Gases
Gases diffuse from areas of higher partial pressure to areas of lower partial pressure. The diffusion along the partial pressure gradient ceases only when the partial pressure in both areas becomes equal. This is true in aquous solutions: within mixtures of gases and across gas-water inter phase. Very seldom diffusion in direction of partial pressure gradient also means diffusion along a concentration gradient. In later sections we shall see how the movement of oxygen and carbon dioxide depends on the partial pressure gradient that exists at the inter phase between vascular: fluids and air in lungs. Within the body at the capillary level the intracellular fluids and vascular fluids develop opposed partial pressure gradients and hence gases move opposite directions.
Having studied the physical basis of gas diffusion we can now proceed to see how animals exchange gases across their respiratory surfaces. First, we shall discuss various arrangements for respiratory gas exchange in animals.
In which areas of the globe is gymnosperm abundance noteworthy? These plants are the typical vegetation of cold regions as the taiga, or boreal forest, of the northern hemisph
Where in the cell can ribosomes be found? What is the main biological function of ribosomes? Ans) Ribosomes can be found free in the cytoplasm, adhered to the outer side of the
Q. What is the incubation period of an infection? The Incubation period is the time interval between the infection by an agent that causes disease and the first signs or sympto
Trout beck zone - Lotic Ecosystem This is larger and more constant than the head stream. The greater volume of torrential water carves channels into exposed rock floor (bed ro
Ecosystem Balance We take up, another parameter of ecosystem balance. One factor that affects the stability or persistence of some ecosystems under small or moderate environme
For a somatic cell with 2n = 4, which of the following is true? (Note: G1- growth phase 1, G2 - growth phase 2, M - metaphase, P - prophase and T - telophase) a. (Number of
Determine the Principle of neuropsychological assessment The neuropsychological assessment of school age of children and adolescents is not primarily a technological enterpris
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Determination of Neural Ectoderm by Induction Earlier you know that the dorsal mesoderm induces the ectoderm to differentiate into neural tissue. Spemann and his co-workers co
locomotion in protozoa
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd