Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. How different are gymnosperms from pteridophytes and bryophytes?
Gymnosperms are not cryptogamic as pteridophytes and bryophytes are. They are phanerogamic and so they form seeds and flowers.
STRESS OF HOSPITALIZATION Stress refers to the imbalance between the environmental and societal demands and the child's coping abilities and resources that puts them in a
What is the difference between xylem and phloem? Both xylem and phloem are vascular tissues found in a plant. Xylem is a tubular structure, which is liable for water transport
Animal products too are widely used in medicines by traditional societies, and in some urbanized societies that believe in traditional animal-based remedies. Examples of such produ
At the beginning of the process in an animal cell, the partition of the centriole takes place, which has been duplicated during Interphase but were in the same centrosome. Bipol
Q. How to Use a Key? The use of a key is analogous to travelling a high way, that forks repeatedly, each fork having roadside directions. If a traveller follows the proper dire
Decomposers - Biotic Components Also known as saprotrophs. Mostly, these are microscopic and are heterotrophic in nature. Decomposer organisms obtain their energy and nutrient
Atherosclerosis, the most common part of hardening of the arteries, is characterized by the presence of cholesterol-rich arterial thickenings (atheromas). This progressive diseas
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is Ridge morphology The implant-supported prosthesis is affected by the ridge morphology especially implant-supported overdentures which gain dual support from implants an
Q. What are some examples of migratory animals? Instance of the migratory animals are southern right whales from Antarctica, that procreate on the Brazilian coast; the migrator
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd