Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the difference between spermatocyte I and spermatogonium?
The male germ cells are the spermatogonia (diploid cells, 2n) situated in the testicles and they mature and by means of mitosis give birth to spermatocytes I (2n) that will undergo meiosis.
REHABILITATION OF CARDIAC SURGICAL PATIENTS The goal of nursing care of cardiac surgical patient is to make the patient to come back to his normal activities. Cardiac surgica
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Starch gelatinization Undamaged starch granules are insoluble in cold water but can imbibe water reversibly i.e. they can swell slightly and then return to their original siz
Define Immediate and Longer term Adjustment to Altitude Hypoxia? Arterial hypoxia precipitates the immediate physiological adjustments to altitude and process of acclimatizatio
Explain about the Chemical Carcinogens? Chemicals have been shown to be carcinogenic. Some are naturally occurring components of plants and microbial organisms. Some are synthe
What are some common laboratory techniques? During the course of these laboratory sessions, you will be usual to become proficient in the performance of the following laborator
1- Describe the function of enzymes in catalyzing biological reactions ? 2-Descride enzymes ' role in reducign activation energy?
VACUOLES They are of 4 types - 1. Sap Vacuole - Outer membrane of sap vacuole is called T onoplast . Sap vacuole contains amino sugars, carotenoids, proteins, m
Q. What do you mean by pollen? Pollen grains are the male gametophytes of the phanerogamic (flowering) plants So within the pollen grains the male gametes of these plants are f
Define about Selenoproteins P and W? The third group comprises of selenoprotein P, an extracellular constituent with multiple selenocysteine molecules. This has an antioxidant
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd