Difference between spermatocyte i and spermatogonium, Biology

Assignment Help:

Q. What is the difference between spermatocyte I and spermatogonium?

The male germ cells are the spermatogonia (diploid cells, 2n) situated in the testicles and they mature and by means of mitosis give birth to spermatocytes I (2n) that will undergo meiosis.


Related Discussions:- Difference between spermatocyte i and spermatogonium

Rehabilitation of cardiac surgical patients, REHABILITATION OF CARDIAC SURG...

REHABILITATION OF CARDIAC SURGICAL PATIENTS The goal of nursing care of cardiac surgical patient is to make the patient to come back to his normal activities. Cardiac surgica

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain starch gelatinization, Starch gelatinization Undamaged starch ...

Starch gelatinization Undamaged starch granules are insoluble in cold water but can imbibe water  reversibly i.e. they can swell slightly and then return to their original siz

Immediate and longer term adjustment to altitude hypoxia, Define Immediate ...

Define Immediate and Longer term Adjustment to Altitude Hypoxia? Arterial hypoxia precipitates the immediate physiological adjustments to altitude and process of acclimatizatio

Explain about the chemical carcinogens, Explain about the Chemical Carcinog...

Explain about the Chemical Carcinogens? Chemicals have been shown to be carcinogenic. Some are naturally occurring components of plants and microbial organisms. Some are synthe

What are some common laboratory techniques, What are some common laboratory...

What are some common laboratory techniques? During the course of these laboratory sessions, you will be usual to become proficient in the performance of the following laborator

Illistrate the role in reducign activation energy, 1- Describe the function...

1- Describe the function of enzymes in catalyzing biological reactions ? 2-Descride enzymes ' role in reducign activation energy?

Vacuoles, VACUOLES They are of 4 types - 1.       Sap Vacuole - ...

VACUOLES They are of 4 types - 1.       Sap Vacuole - Outer membrane of sap vacuole is called T onoplast . Sap vacuole contains amino sugars, carotenoids, proteins, m

What do you mean by pollen, Q. What do you mean by pollen? Pollen grain...

Q. What do you mean by pollen? Pollen grains are the male gametophytes of the phanerogamic (flowering) plants So within the pollen grains the male gametes of these plants are f

Define about selenoproteins p and w, Define about Selenoproteins P and W? ...

Define about Selenoproteins P and W? The third group comprises of selenoprotein P, an extracellular constituent with multiple selenocysteine molecules. This has an antioxidant

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd