Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the difference between primary ecological succession and secondary ecological succession?
The Primary ecological succession is the changing sequence of communities from the first biological occupation of a place where previously there were no living beings. For instance, the colonization and the following succession of communities on a bare rock.
The Secondary ecological succession is the changing sequence of communities from the substitution of a community by a new one in a given place. For instance, the ecological succession of the invasion of plants and animals in an abandoned crop or land.
Q. Show Foods that damage GI mucosa? Foods that damage GI mucosa: A number of spices, herbs and other condiments have been found to have little or no irritating effect on the m
biological significant of a skeleton
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
what is giardia lamblia and deasis
filter feeding mode of nutrition is observed in- a) amoeba b) euglena c)paramoecium d) all of the above
Q. Why is the AIDS treatment often done with a drug cocktail? The treatment of obtain immune deficiency syndrome is often done with one or more anti-retroviral drugs of differe
Define the term - lateralisation and localisation Discriminative validity studies including lateralisation and localisation achieved satisfactory results, but the localisation
Q. How is the cooling of tissues and organs for medical transplants associated with the effect of temperature upon enzymatic reactions? The molecular degradation during the dec
SODIUM The element is available in table salt. A proper balance of sodium and potassium is essential. Its absorption is under control of aldasterone. The various f
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd