Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. How different are hemoglobin and oxyhemoglobin?
Where is it expected to find a higher concentration of oxyhemoglobin, in peripheral tissues or in the lungs?
Oxygen-bound hemoglobin is called as oxyhemoglobin in the lungs the oxygen concentration is higher and so there is a higher oxyhemoglobin concentration. In the peripheral tissues the situation is the reverse the concentration of oxygen is lower and there is more free hemoglobin.
What do you understand by Arthropodization? Many of the traits that we consider unique to the Arthropoda may not be independent traits. Instead, they may be the consequence of
Explain Two major causes of severe Protein Energy Malnutrition? Two major causes of severe PEM are diluted milk formulae and infections, especially diarrhoea in poor communiti
State about the blood ocular barriers of the eye? Blood Ocular Barrier: All vascular beds of the eye are highly permeable to lipoid soluble substances (oxygen, carbon dio
How do the ideas of energy and chemical cycles, community structure, biodiversity and succession fit together to form the basis of the way the natural world works?
Minerals :- Manganese Food Source Whole grains, fruits, vegetables Nutritional Functional role Essential nutrient: Deficiency extremely rare. Enzyme cofactor
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Which are the specialized conductive tissues of the plants? The vascular tissues of the plants are the xylem and the phloem. Xylem is the plant tissue that forms the vessels t
Biomass energy Energy produced by burning biomass it is known as biomass energy. When biomass is burnt, it releases stored chemical energy, which has accumulated in it through
Define Polyacrylamide gel electrophoresis (PAGE)? Acrylamide gel has the advantage over starch in that it is easier to prepare and is more inert, the pore size can be varied in
What is the primary structure of a protein? What is the significance of the primary structure? The primary protein structure is the linear sequence of amino acids that form the
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd