Difference between hemoglobin and oxyhemoglobin, Biology

Assignment Help:

Q. How different are hemoglobin and oxyhemoglobin?

Where is it expected to find a higher concentration of oxyhemoglobin, in peripheral tissues or in the lungs?

Oxygen-bound hemoglobin is called as oxyhemoglobin in the lungs the oxygen concentration is higher and so there is a higher oxyhemoglobin concentration. In the peripheral tissues the situation is the reverse the concentration of oxygen is lower and there is more free hemoglobin.


Related Discussions:- Difference between hemoglobin and oxyhemoglobin

What do you understand by arthropodization, What do you understand by Arthr...

What do you understand by Arthropodization? Many of the traits that we consider unique to the Arthropoda may not be independent traits. Instead, they may be the consequence of

Two major causes of severe protein energy malnutrition, Explain Two major c...

Explain Two major causes of severe Protein Energy Malnutrition? Two major causes of severe PEM are diluted milk formulae and infections, especially diarrhoea in poor communiti

State about the blood ocular barriers of the eye, State about the blood ocu...

State about the blood ocular barriers of the eye? Blood Ocular Barrier: All vascular beds of the eye are highly permeable to lipoid soluble substances (oxygen, carbon dio

The ideas of energy and chemical cycles, How do the ideas of energy and che...

How do the ideas of energy and chemical cycles, community structure, biodiversity and succession fit together to form the basis of the way the natural world works?

Describe the nutritional and functional role of manganese, Minerals :- Mang...

Minerals :- Manganese Food Source      Whole grains, fruits, vegetables Nutritional Functional role Essential nutrient: Deficiency extremely rare. Enzyme cofactor

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Which are the specialized conductive tissues of the plants, Which are the s...

Which are the specialized conductive tissues of the plants? The vascular tissues of the plants are the xylem and the phloem. Xylem is the plant tissue that forms the vessels t

Biomass energy, Biomass energy Energy produced by burning biomass it is...

Biomass energy Energy produced by burning biomass it is known as biomass energy. When biomass is burnt, it releases stored chemical energy, which has accumulated in it through

Define polyacrylamide gel electrophoresis (page), Define Polyacrylamide gel...

Define Polyacrylamide gel electrophoresis (PAGE)? Acrylamide gel has the advantage over starch in that it is easier to prepare and is more inert, the pore size can be varied in

What is the primary structure of a protein, What is the primary structure o...

What is the primary structure of a protein? What is the significance of the primary structure? The primary protein structure is the linear sequence of amino acids that form the

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd