Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the difference between ectoparasite and endoparasite?
The Ectoparasites are parasites that explore the external surface of the host (like, for instance, mites that parasite the skin). Endoparasites are parasites that live within the body of the host (like the taenias).
Explain the Occurrence of vitamin B 2 Vitamin B 2 (riboflavin) occurs in nature almost exclusively in a combined form i.e. esterified with phosphoric acid as riboflavin-5'-ph
Q. Can you explain Cholera? Cholera is one of the diseases which had caused epidemics all over the world. The organism which causes the disease is Vibrio cholerae. It is an
Explain the Protection of erythrocytes and cell membrane? Protection of erythrocytes: Vitamin E protects erythrocytes from haemolysis by the production of oxidizing agents
Options with Rifampin Standard 4-drug treatment regimens including rifampin can be given to HIV-infected patients with active TB who are simultaneously receiving HAART if the H
Q What is the way of life of sponges? Sponges live exclusively in an aquatic environment and they are attached by their base to a substrate fixation ground. Sponges are filteri
Define the factors effect the Quantity of Human Milk? A large healthy baby who can vigorously suck will induce and obtain much more milk from its mother than a small, sickly or
Explain the various types of Protein Structure? Protein Structure : The structure of proteins can be examined at four levels of increasing complexity, with the primary struc
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Alkaline Phosphatase is an enzyme which catalyzes the hydrolysis of the phosphomonoesters of the 5' nucleotides. It is used to dephosphorylate (remove phosphate groups from) the 5
Soybean protein used as stabilized dispersions Soybean protein concentrates have been used as stabilized dispersions in milk-like beverages and simulated dairy products, such a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd