Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
DIFFERENCES BETWEEN "A" AND "I" BANDS
A-Band (Anisotropic band)
I-Band (Isotropic band)
1.
It has wide H-zone.
It has thin Z-line.
2.
It gives dark appearance and hence also
It gives light appearance hence also called
3.
called dark band.
It contains myosin filaments and parts of
light band.
It contains part of actin filaments.
actin filaments.
4.
Its length remains unchanged during
It shortens during muscle contraction.
muscle contraction.
Q. Can you explain Lane and Eynon method? Reducing sugars are those, which have free sugar groups (e.g. glucose, fructose etc.) and hence may be estimated directly by titrat
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Find the initial osmotic pressure at room temperature for a cell if the only ions present are KCl and NaCl on either side of the membrane. Assume the concentrations for K+ and Na+
ROL E OF GLUCOSE - Maximum part of energy in percentage is obtained by oxidation of glucose. Energy is released quickly. In blood .1% glucose (C6H12O6) present. Norma
Define Nutritional Requirements of Fats and Oils? As with the other macronutrients, we do compute requirements of visible fats too for all age groups and give guidelines for se
Convert 3.5°F to Celsius Four hundred pounds is how many kilograms?
What are all possibilities of genotypes and phenotypes formed in the combination of alleles responsible for the production of factor VIII? Considering the alleles X and Xh, whe
Solubility and physical properties of protiens Simple proteins Conjugated proteins Derived proteins
Q What is the other name given to the sex chromosomes? What is the function of the sex chromosomes? Sex chromosomes are also known as allosomes the other chromosomes that are n
Explain the Jejuno ileal Bypass and Jaw Wiring? Jejuno-ileal Bypass: Absorptive surface of the small intestines can also be reduced through surgery called the jejuno-ileal by p
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd