Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Differance between pulsus bigerniny or trigeminy and presence of bruit ?
Pulsus bigerniny or trigeminy: After every 2nd or 3rd beat respectively there will be a longer interval. This is due to occurrence of a premature beat every 2nd or 3rd beat.
Presence of bruit: Presence of bruit over peripheral pulses especially over the carotids and renal arteries are very important clinical finding denoting stenosis in these arteries.
Q. Percentage ratio of total Solids and Water in honey? Most genuine honeys contain 13-23 per cent of water. The total solids or moisture can be estimated by drying in a vacuu
K.L. is a 30-year-old Caucasian male was brought to Emergency Department (ED) after a bicycle accident. He was hit from behind by a compact car traveling at 35 miles per hour. On
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
PROVIDE a specific example for epithelial and connective tissues, how the arrangement of cells helps with tissue functioning?
Properties of Sols Sol, is a solid liquid dispersion with solid or semi-solid particles dispersed in a continuous liquid phase. For e.g. starch in cold water. Sols exhibit ch
Explain the Recommended Dietary Allowances - Nutrition? The recommended dietary allowances are defined as the 'daily dietary intake level that is sufficient to meet the nutrien
CHEMICA L COMPOSITION OF CHROMATIN Chromatin threads composed of DNA (31 %), RNA (2-5%) and proteins (Histon-36%, Non histon 28%). Histone and protamines are basic prote
Bovine spongiform encephalopathy The bovine transmissible spongiform encephalopathy (BSE), known as 'mad cow disease'-first noticed in Great Britain in 1986, is similar to scra
Define Exclusion chromatography - basic separation technique? It is a chromatographic process, in which separation of the sample components takes place according to the molecul
Amelioration of mineral deficiency Performance of livestock in the tropics is mainly governed by the quality and quantity of nutrients provided in the diet. In most of the dev
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd