Differance between pulsus bigerniny or trigeminy presence, Biology

Assignment Help:

Differance between pulsus bigerniny or trigeminy and presence of bruit ?

Pulsus bigerniny or trigeminy: After every 2nd or 3rd beat respectively there will be a longer interval. This is due to occurrence of a premature beat every 2nd or 3rd beat.

Presence of bruit: Presence of bruit over peripheral pulses especially over the carotids and renal arteries are very important clinical finding denoting stenosis in these arteries.


Related Discussions:- Differance between pulsus bigerniny or trigeminy presence

Percentage ratio of total solids and water in honey, Q. Percentage ratio of...

Q. Percentage ratio of total Solids and Water in honey? Most genuine honeys contain 13-23 per cent of water. The total solids or moisture can be estimated by drying in a vacuu

Pneumothorax, K.L. is a 30-year-old Caucasian male was brought to Emergency...

K.L. is a 30-year-old Caucasian male was brought to Emergency Department (ED) after a bicycle accident.  He was hit from behind by a compact car traveling at 35 miles per hour.  On

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How the arrangement of cells helps with tissue functioning, PROVIDE a speci...

PROVIDE a specific example for epithelial and connective tissues, how the arrangement of cells helps with tissue functioning?

Determine the properties of sol, Properties of Sols Sol, is  a solid l...

Properties of Sols Sol, is  a solid liquid dispersion with solid or semi-solid particles dispersed in a continuous liquid phase. For e.g. starch in cold water. Sols exhibit ch

Explain the recommended dietary allowances - nutrition, Explain the Recomme...

Explain the Recommended Dietary Allowances - Nutrition? The recommended dietary allowances are defined as the 'daily dietary intake level that is sufficient to meet the nutrien

Chemical composition of chromatin, CHEMICA L COMPOSITION OF CHROMATIN ...

CHEMICA L COMPOSITION OF CHROMATIN Chromatin threads composed of DNA (31 %), RNA (2-5%) and proteins (Histon-36%, Non histon 28%). Histone and protamines are basic prote

Bovine spongiform encephalopathy, Bovine spongiform encephalopathy The ...

Bovine spongiform encephalopathy The bovine transmissible spongiform encephalopathy (BSE), known as 'mad cow disease'-first noticed in Great Britain in 1986, is similar to scra

Define exclusion chromatography - basic separation technique, Define Exclus...

Define Exclusion chromatography - basic separation technique? It is a chromatographic process, in which separation of the sample components takes place according to the molecul

Amelioration of mineral deficiency, Amelioration of mineral deficiency ...

Amelioration of mineral deficiency Performance of livestock in the tropics is mainly governed by the quality and quantity of nutrients provided in the diet. In most of the dev

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd