Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the osseous cavity where the pituitary gland is located? The hypophysis or pituitary gland is located in the sella turcica of the sphenoid bone (one of the bones in
Explain about the Protein Isolates? Before we begin our discussion on protein isolates, let us first get to know how protein concentrates differ from isolates. Basically, the t
What are the elements that constitute the stomata? The Stomata is made of a central opening the ostiole or slit delimited by two guard cells responsible for its closing or open
Explain Pregnancy and Diabetes Mellitus? During pregnancy, a woman who has pre-existing chronic disease requires special care, especially in case of mother's suffering from dia
Explain about the Chromium Metabolism? Chromium appears to be absorbed throughout the small intestine, with absorption being higher in jejunum. The mechanism of absorption has
Explain the Pour Plate Method Isolated colonies can also be obtained by pour plate method. The method involves mixing of small volume of microbial suspension with molten nutrie
Characteristics Define Cancer - Hyperplasia Hyperplasia is the extreme proliferation of cells which can be observed in normal as well as cancerous tissues. In normal tissue, a
Q What are halophile, methanogen archaebacteria and thermoacidophile? There are three peculiar types of archaebacteria the halophile archaebacteria only survive in salt-rich en
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is the significance of mitosis for the embryonic development? Every embryo grows from a single cell that bears mitosis and generates other cells that also divide themse
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd