diet, Biology

Assignment Help:
heating a food sample with Benedict''s solution is a test for...

Related Discussions:- diet

What do you mean by osseous cavity, Q. What is the osseous cavity where the...

Q. What is the osseous cavity where the pituitary gland is located? The hypophysis or pituitary gland is located in the sella turcica of the sphenoid bone (one of the bones in

Explain about the protein isolates, Explain about the Protein Isolates? ...

Explain about the Protein Isolates? Before we begin our discussion on protein isolates, let us first get to know how protein concentrates differ from isolates. Basically, the t

What are the elements that constitute the stomata, What are the elements th...

What are the elements that constitute the stomata? The Stomata is made of a central opening the ostiole or slit delimited by two guard cells responsible for its closing or open

Explain pregnancy and diabetes mellitus, Explain Pregnancy and Diabetes Mel...

Explain Pregnancy and Diabetes Mellitus? During pregnancy, a woman who has pre-existing chronic disease requires special care, especially in case of mother's suffering from dia

Explain about the chromium metabolism, Explain about the Chromium Metabolis...

Explain about the Chromium Metabolism? Chromium appears to be absorbed throughout the small intestine, with absorption being higher in jejunum. The mechanism of absorption has

Explain the pour plate method, Explain the Pour Plate Method Isolated c...

Explain the Pour Plate Method Isolated colonies can also be obtained by pour plate method. The method involves mixing of small volume of microbial suspension with molten nutrie

Characteristics define cancer - hyperplasia, Characteristics Define Cancer ...

Characteristics Define Cancer - Hyperplasia Hyperplasia is the extreme proliferation of cells which can be observed in normal as well as cancerous tissues. In normal tissue, a

Describe methanogen archaebacteria and thermoacidophile, Q What are halophi...

Q What are halophile, methanogen archaebacteria and thermoacidophile? There are three peculiar types of archaebacteria the halophile archaebacteria only survive in salt-rich en

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain significance of mitosis for embryonic development, Q. What is the s...

Q. What is the significance of mitosis for the embryonic development? Every embryo grows from a single cell that bears mitosis and generates other cells that also divide themse

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd