Diabetes mellitus, Biology

Assignment Help:

1. How often should she have Glycated hemoglobin (HgbA1C) drawn?  What percentage is desired?

2. How often should she see an ophthalmologist or optometrist?

3. What should be her daily limit of calories?

4. Her healthcare provider prescribes 10 units of Lantus at bedtime. You are responsible for teaching her about Lantus. List the key points about Lantus.

5. What should her blood glucose be after eating a meal (post-parandial)?  What is normal post-prandial blood glucose in people without diabetes?

6. Her healthcare provider prescribes Lispro for Mary's post-parandial blood glucose spikes. She is to give 3 units Lispro for this spike. How will Mary administer this and at what time?

7. Mary (Type I) is encouraged to exercise at a minimum of 30 minutes daily. What special instructions should you give Mary?

Mary gives herself every morning 75/25 Lispro Protamine 43 units Subq and for each evening: 23 units of 75/25 Lispro Protamine Subq,and then Lantus 10 units @ H.S. subq

8. Determine how many units are the long-acting and how many are the short acting for morning and evening dose of 75/25 She is to check her blood sugar prior to eating at lunch: and give Humalog (lispro) 3 units ac lunch

9. How many syringes could Mary utilize each day?

10. Could an insulin pen with her scheduled doses help prevent errors?

Mary begins to feel muscle aches, low grade fever, coughing, and a severe sore throat. When she checks her blood sugar she finds it 450 mg/dl. He physician admits her to the hospital with the following orders:

Accuchecks q 30 mins until BG is less than 300 mg/dl, then q hr

1) Hydrate with 1 liter of N.S, give 500 mL over 2 hours then add an insulin drip

2) Begin an insulin drip with Humalog (Lispro) at 10 units/hr. Add 100 units to 250 mL N.S. Determine how many mL/hr will the nurse set the pump?


Related Discussions:- Diabetes mellitus

Fats are essential for meeting nutritional need of essential, Why Fats are ...

Why Fats are essential for meeting nutritional need of essential? Fats are essential for meeting nutritional needs of essential, fatty acids like linoleic acid (n-6) and alpha

Define methods of food processing, Define Methods of Food Processing? F...

Define Methods of Food Processing? Food is undeniably most vital to the survival of human beings. Hence, it must be processed using various scientific techniques. This is done

Genetics, what about cytoplasmic sex determination

what about cytoplasmic sex determination

Transmission electron microscopy, Transmission electron microscopy: Ar...

Transmission electron microscopy: Around 1931-32 two German scientists. Knoll and Ruska. Invented transmission electron microscopy, and built the first transmission electron m

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Advantage of using the regulatory strategy of enzyme, You have two enzymes,...

You have two enzymes, 1 and 2. Both convert substance A into substance B. 1 is inhibited by B, because B partially blocks the active site and will not allow more A to enter. 2 is i

Explain the consequences of malnutrition, Explain the Consequences of Malnu...

Explain the Consequences of Malnutrition? Malnutrition manifests itself in terms of illness and death in all age groups. Children, pregnant women, nursing mothers and elderly a

Name the enzyme included in the continuous replication, Mention the informa...

Mention the information that the health workers get by measuring BOD of a water Body. a) Name the enzyme included in the continuous replication of DNA strand. Mention the Polar

What is the probability of carrier of the recessive allele, Two parents who...

Two parents who are each known to be carriers of an autosomal recessive allele have four children. None of the children has the recessive condition. What is the probability that

Define features of fusarium - fungi and yeast, Define features of Fusarium ...

Define features of Fusarium - Identification of Fungi and Yeasts? Identifying features of Fusarium: 1. Wooly, white fuzzy colonies changing colour to pink, purple or yellow.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd