Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the formula of the net primary production (NPP)? How does NPP relate to the energy pyramids? The Net primary production is the gross primary productivity less the or
different type of respiration in animals
Japanese encephalitis Japanese encephalitis (JE) is a mosquito-borne encephalitis and is caused by flavivirus belonged to the family Flaviviridae. It is a zoonotic disease, i
Why plant nutrients said to be essential An element is said to be essential if, (i) The deficiency of an element in plant, makes it impossible to complete the vegetative
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the so-called "good" and "bad" cholesterol? Lipoproteins are complexes made of lipids (cholesterol and triglycerides) and proteins. The lipoproteins present differe
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
There may also be non-use existence values for components of biological diversity due to the value placed on biodiversity purely based on its continued existence, irrespective of w
Ideal Characteristics 1) Maximize gas transfer (oxygen, carbon dioxide and anaesthetic gases) 2) Minimize blood trauma 3) Good heat transfer efficiency 4) Minimize
Discuss the biological importance of Imidazole. Bring in examples of biomolecules that contain this group. Please be as thorough as possible.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd