Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Developmental Patterns - Metazoa
The metazoans or Animalia can be divided into two groups on the basis of body symmetry. The bilateral metazoans can be divided into two great assemblages: the Protostomia and the Deuterostomia.
Platyhelminthes, Molluscs, Annelida, Arthropods and a number of minor phyla are classified as Protostomes while Echinodennata, Chordata and at least two minor phyla are included in the deuterostomes. The features used to place animals in these groups are largely developmental.
Determine Requirement of Trace elements for Infant? Most elements, such as zinc and iodine, hold a major significance in infant nutrition. Zinc is associated with growth while
Q. Concerning tissue complexity how dissimilar are cnidarians from poriferans? Poriferans present only some dispersed specialized cells with no tissue differentiation, Cnidaria
Which of the following best explains the reason why DNA ligase is needed to complete the replication of internal chromosomal segments? A. DNA ligase is able to delete the last
Specific Organization The body of all living things, no matter how different in size or appearance, is composed of cells. Viruses are of course an exception. The study of cell
Q. What is the difference between the concepts of genome and karyotype? Genome is the set of DNA molecules that characterizes each species or each living being. The concept the
Carbon is important constituents of all organic compounds. It forms 49% of dry weight of the organisms. Earth atmosphere contains 0.03% carbon dioxide gas. The c
Most RNA molecules are single-stranded but an RNA molecule should hold regions that can form complementary base pairing where the RNA strand loops back on i
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Competence of Larval Tissue or Multiple Responses The responsiveness of different larval tissues to thyroxine is markedly different. The tissues of the tail becomes necrotic
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd