Developmental patterns - metazoa, Biology

Assignment Help:

Developmental Patterns - Metazoa

The metazoans or Animalia can be divided into two groups on the basis of body symmetry. The bilateral metazoans can be divided into two great assemblages: the Protostomia and the Deuterostomia.

Platyhelminthes, Molluscs, Annelida, Arthropods and a number of minor phyla are classified as Protostomes while Echinodennata, Chordata and at least two minor phyla are included in the deuterostomes. The features used to place animals in these groups are largely developmental.


Related Discussions:- Developmental patterns - metazoa

Determine requirement of trace elements for infant, Determine Requirement o...

Determine Requirement of Trace elements for Infant? Most elements, such as zinc and iodine, hold a major significance in infant nutrition. Zinc is associated with growth while

How dissimilar are cnidarians from poriferans, Q. Concerning tissue complex...

Q. Concerning tissue complexity how dissimilar are cnidarians from poriferans? Poriferans present only some dispersed specialized cells with no tissue differentiation, Cnidaria

State the internal chromosomal segments, Which of the following best explai...

Which of the following best explains the reason why DNA ligase is needed to complete the replication of internal chromosomal segments? A. DNA ligase is able to delete the last

Specific organization, Specific Organization The body of all living th...

Specific Organization The body of all living things, no matter how different in size or appearance, is composed of cells. Viruses are of course an exception. The study of cell

What is the difference between the concepts of genome, Q. What is the diffe...

Q. What is the difference between the concepts of genome and karyotype? Genome is the set of DNA molecules that characterizes each species or each living being. The concept the

Carbon cycle, Carbon is important constituents of all organic compounds. It...

Carbon is important constituents of all organic compounds. It forms 49% of dry weight of the organisms.  Earth atmosphere contains 0.03% carbon dioxide gas.               The c

Rna secondary structure, Most  RNA  molecules  are  single-stranded  but  a...

Most  RNA  molecules  are  single-stranded  but  an  RNA  molecule  should  hold regions  that  can  form  complementary   base  pairing  where  the  RNA  strand loops  back  on  i

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Competence of larval tissue or multiple responses, Competence of Larval Tis...

Competence of Larval Tissue or Multiple Responses The responsiveness of different larval tissues to thyroxine is markedly different. The tissues of the tail becomes necrotic

Regulation of ovarian activity, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd