Developing a strategy for improvement in the rural economy, Biology

Assignment Help:

Define Developing a strategy for improvement in the rural economy?

It is necessary to develop a strategy that results in improvement in the rural economy. This could be achieved by framing policies which can pump more money into the rural sector. This would also result in improvement of employment opportunities in the rural areas. It can thus be concluded that, for successful food production, it is necessary to understand the decision making process of the farmers and the policy formulated accordingly. So we studied about the four issues related to food production. These are factors influencing food production, analyses of food production, understanding the response of fanners and developing a strategy, A thorough understanding of these issues is important before making a policy change and planning an intervention to improve food production in the country.


Related Discussions:- Developing a strategy for improvement in the rural economy

Consequence of over population, CONSEQUENC E OF OVER POPULATION - With...

CONSEQUENC E OF OVER POPULATION - With increase in population the available natural resources will fall short of requirements. A severe competition will ensure creating soc

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Social determinants of health - social exclusion, Social Determinants of He...

Social Determinants of Health - Social Exclusion Given that absolute poverty is a major determinant of ill-health, the resultant social exclusion is ‘psychologically damaging,

Procedure for morphological characteristics of yeast cells, Procedure for M...

Procedure for Morphological Characteristics of Yeast Cells? Now carry out the exercise following the steps enumerated herewith: (1) Label the clean, non-greasy slide. Put fe

What type of bonds is susceptible to hydrolysis, What type of bonds is susc...

What type of bonds is susceptible to hydrolysis? Book examples are C-N and C-OH.

Give the causative organism of bacillary dysentery, Give the causative orga...

Give the causative organism and symptoms of Bacillary Dysentery • Bacillary dysentery is caused by  Shigella sp. (Shigella sonnei, S. dysenteraei). Incubation period is

Acclimation and acclimatisation, Normal 0 false false false...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Dideoxy sequencing, Dideoxy Sequencing is the enzymatic determination and ...

Dideoxy Sequencing is the enzymatic determination and consideration of DNA or RNA sequence by the rechnique of Sanger and colleagues, based on incorporation of the chain terminati

Kingdom animalia, Locomotion and reproduction in echinodermata

Locomotion and reproduction in echinodermata

What is the dosage and cost of micafungin, Dosage and cost of micafungin ...

Dosage and cost of micafungin The recommended dosage of micafungin is 50 mg/day for prophylaxis and 150 mg/day for treatment, both given IV as a single dose over 1 hour.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd