Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Detritus Food Chains
Detritus food chains begin with dead organic matter which is an important source of energy. A large amount of organic matter is contributed by the death of plants, plant parts, animals and their excretion products. These types of food chains are present in all ecosystems but they are over dominating in forest ecosystems and shallow water communities. Various species of microscopic fungi, bacteria and other saprophytes play a prominent role in decomposing organic matter to obtain energy needed for their survival and growth. In this process they release various nutrients, locked in dead organic matter, which are used readily by the green plants. Detritus food chains are interconnected with grazing food chains and other auxiliary food chains through certain specific common organisms to permit crossing over of energy and material flow from one circuit to another.
For example, cattle do not assimilate all of the energy stored in plants, undigested residues in faeces become available for the decomposers and the detritivores. Detritus food chains are located mainly in the soil or in the segments of aquatic ecosystems. They form an essential component of natural ecosystems and are necessary for self-sustenance and for maintaining ecological balance. Detritus food chains can be of great practical value for modern man for sewage treatment and control of water pollution. Most of the natural ecosystems possess both grazing and detritus types of food chains. Their relative importance however, varies from one ecosystem to another. In terrestrial and shallow water ecosystems, detritus food chains dominate because a major proportion of the annual energy flow passes through this circuit. In case of tidal marshes, almost 90 per cent of the primary production is routed through the detritus food chains. In deep water aquatic systems rapid turnover of organisms and high rate of harvest are responsible for the dominance of grazing food chains.
Q What do protozoans "eat"? Do they move in search for food? Protozoans are heterotroph beings that are they do not make their own food and thus they need to search for it in t
Q. What is Tyrosinemia? There are two forms of hereditary tyrosinemia. They are tyrosinemia Type I and tyrosinemia Type II. Type I was thought to be due to a deficiency of para
Define Erythropoietin A. acts by stimulating the production of red blood cells by the peritubular interstitial cells of the kidney cortex. B. is secreted by cells in the bon
what are phototrophs
Plant Responses to Light-Dark Cycles Based on their requirement for day length (number of hours of light) for flowering plants have been grouped under three major categories,
A person has swelling on the front of his neck. Name the disease he is suffering from and the cause of it.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. For each of the three kinds of life cycles what is the respective ploidy of the individual that represents the adult or lasting form? In the haplontic haplobiontic life cycl
subject for botany assignment
Explain Water and electrolyte imbalance during kwashiorkor? The total body water and especially the extracellular fluid volume are increased in all forms of PEM. At the same ti
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd