Determine which is most stable, Biology

Assignment Help:

Hydrogen ( H) has 1 electron, carbond ( c) has 6 electrons ; oxygen ( O) has electrons, Nitrogen ( n) HAS 7 electrons. Use the octet rule to determine which of the following is most stable. Note: some of these may have double bonds.

A. CN
B. CH3NH2
C. N2H2
D. C3H
E. OH4

Related Discussions:- Determine which is most stable

Define conjunctival xerosis - micronutrient deficiencies, Define Conjunctiv...

Define Conjunctival Xerosis - Micronutrient Deficiencies? Conjunctiva in nonnal children is bright white, smooth and glistening. Conjunctival xerosis is characterized by drynes

Find the magnitude of the acceleration of the proton, A proton accelerates ...

A proton accelerates from rest in a uniform electric field of 650 N/C. At some later time, its speed is 1.3 106 m/s. (a) Find the magnitude of the acceleration of the proton. m/s2

minerals, Minerals Minerals are chemical elements needed by the body ei...

Minerals Minerals are chemical elements needed by the body either to help form bodily structures or to facilitate chemical reactions. Dietary minerals are divided into two categ

Drugs and insulin used in diabetes, Q. Drugs and Insulin used in diabetes? ...

Q. Drugs and Insulin used in diabetes? When diet, exercise or even weight reduction do not improve the diabetic symptoms and blood sugar levels, the uses of hypoglycemia drugs

Explain casein, Explain Casein Casein is an important example of protei...

Explain Casein Casein is an important example of protein, which can be boiled without apparent change in stability. The exceptional stability of casein makes it possible to boi

Describe class ophiuroidea in general way, Describe Class Ophiuroidea in ge...

Describe Class Ophiuroidea in general way? Brittle stars have a central disc with five long, thin, flexible arms that can be detached from the body at will in times of danger.

Explain the advantage of internal fertilization, For animals, what is the a...

For animals, what is the advantage of internal fertilization and what type of species utilize it?

Procedure of hormone act, Procedure of Hormone Act All plant hormones ...

Procedure of Hormone Act All plant hormones show extraordinary varied complex effects in controlling plant growth and development, Extrapolation from how an animal hormone wor

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Advice on dischargeperi operative problems, Advice on Discharge : Patient...

Advice on Discharge : Patients are allowed to go home on 8th or 9th day. It could be even earlier after off pump coronary artery surgery (OPCAB). They should gradually increase t

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages