Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Determine the three types of joints
There are three types of joints :
Fixed or immovable or fibrous : There is no space between the bones. The attached bones are very tightly held with the help of connective tissue. Sutures present between the skull bones and the articulation of the roots of teeth with sockets of maxillae and mandible, are two examples of such a joint.
Slightly movable or cartilaginous : It is an articulation between the bones that allows little movement. In such joints, the opposing surfaces are connected by fibro cartilage.
The joints between two adjacent vertebrae are of this type.
Movable Joints or Synovial joints: It is a joint along the movement of articulating bones, so that they can move extensively upon each other. In these joints a spaceBasics of Diabetes Mellitus between the bones is present, called synovial cavity. The cavity remains full with a viscous and slippery fluid called the Synovial Fluid. Synovial joints may be i) Ball and Socket joints (shoulder, hip), ii)Hinge Joints (elbow, knee, ankle), iii) Pivot joints (permits rotation only), iv) Gliding joints (vertebrae) and v) Condyloid (are like hinge joint allow lateral movement) and Saddle joints (allow free hinge like movements).
what is the protozoa?
Starch Retrogradation The starch paste or solution obtained after the gelatinisation is not stable and generally produces a viscoelastic, firm and rigid gel. Structural transf
A In taxonomy, what is a "KEY" ? List the different types of keys. How are they prepared and what are they used for ?sk question #Minimum 100 words accepted#
What is the feeding habitat of branchiostoma?
Q. What is the main molecule responsible for the absorption of photic energy for photosynthesis? And where is that molecule located in photosynthetic cells? The chlorophyll mol
How do the availability of water and light and the climate affect the growth of a population? The availability of water and light and the climate are abiotic factors that limi
Osmoregulation in Aqueous Environments You are aware that the aqueous environments are of two types: i) Freshwater and ii) Seawater. The osmotic concentration of thes
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q What is the usual reproduction cycle of a DNA virus? A usual virus has proteins on its capsid that bind to the outer membrane of the host cell. In the place where the virus a
regenerstion in invertebrates
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd